Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 63

1.

rs17582416 [Homo sapiens]
    GACTTCAAGATGAATTACATGTAGA[G/T]TGTGAAAGACATGAGTAAAGGGCCG
    Chromosome:
    10:34998722
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    G=0.2967/1486
    HGVS:
    CM000672.2:g.34998722T>G, NC_000010.10:g.35287650T>G
    2.

    rs17309827 [Homo sapiens]
      CACTCAAAAGGCTTGCCCAGGTCAT[G/T]CTTACAAAAAGGGAGGATAAATAGG
      Chromosome:
      6:3433084
      Gene:
      SLC22A23 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      G=0.2704/1354
      HGVS:
      CM000668.2:g.3433084T>G, NC_000006.11:g.3433318T>G, NC_000006.12:g.3433084T>G, NM_001286455.1:c.-190+11735A>C, NM_001286456.1:c.655-17229A>C, NM_015482.1:c.655-17229A>C, NM_021945.6:c.-434-746A>C, NR_104448.1:n.195+11735A>C, XR_001743575.1:n.726+5400A>C
      3.

      rs13361189 [Homo sapiens]
        ACCCAAGCAGAGTGTGCTTGAAAAT[C/T]GGATGTATATTAGTAGACCCCGTGC
        Chromosome:
        5:150843825
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency
        Global MAF:
        C=0.3033/1519
        HGVS:
        CM000667.2:g.150843825T>C, NC_000005.10:g.150843825T>C, NC_000005.9:g.150223387T>C, NG_027809.1:g.2303T>C, NG_027809.2:g.2303T>C
        4.

        rs13003464 [Homo sapiens]
          GCGCACCACTGCACTCGGCAGAGCA[A/G]TCATCTTGAGAGAGGACAGGCAGAT
          Chromosome:
          2:60959694
          Gene:
          PUS10 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.3978/1992
          HGVS:
          CM000664.2:g.60959694A>G, NC_000002.11:g.61186829A>G, NC_000002.12:g.60959694A>G, NM_001322123.1:c.1000+698T>C, NM_001322124.1:c.1000+698T>C, NM_001322127.1:c.331+698T>C, NM_144709.3:c.1000+698T>C
          5.

          rs12529198 [Homo sapiens]
            CTAGTACTCTCATGGCATGGCTAGA[A/G]GTGACCTTTACTTATTTAACCTCTT
            Chromosome:
            6:5151013
            Gene:
            LYRM4-AS1 (GeneView) LYRM4 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.1532/767
            HGVS:
            CM000668.2:g.5151013A>G, NC_000006.11:g.5151247A>G, NC_000006.12:g.5151013A>G, NG_051651.1:g.114938T>C, NM_001164841.2:c.208-6751T>C, NM_001318782.1:c.208-12274T>C, NM_001318783.1:c.207+65604T>C, NM_001318783.1:c.207+65605T>C, NM_020408.5:c.208-41522T>C, NR_104417.1:n.425-37596T>C, NR_104418.1:n.304-41522T>C, NR_126015.1:n.373+78279A>G, NR_134856.1:n.424+65604T>C, NR_134856.1:n.424+65605T>C
            6.

            rs11584383 [Homo sapiens]
              TGGCCTTCTGGGGTAGAGCCACTTG[C/T]AAGCCGCCTTCTTGCCTATGCACAT
              Chromosome:
              1:200966738
              Gene:
              MROH3P (GeneView)
              Functional Consequence:
              downstream variant 500B
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.1536/769
              HGVS:
              CM000663.2:g.200966738T>C, NC_000001.10:g.200935866T>C, NC_000001.11:g.200966738T>C, NR_147176.1:n.2354T>C, XR_001738360.1:n.3338T>C, XR_001738361.1:n.1680T>C, XR_001738362.1:n.1629T>C, XR_001738363.1:n.1560T>C, XR_241169.1:n.2348T>C
              7.

              rs11465804 [Homo sapiens]
                TTAGGCTTTTTGAGTAGTCTTTTAG[G/T]AATTGCCCATTTTAACCCATCATAC
                Chromosome:
                1:67236843
                Gene:
                IL23R (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                G=0.0341/171
                HGVS:
                CM000663.2:g.67236843T>G, NC_000001.10:g.67702526T>G, NC_000001.11:g.67236843T>G, NG_011498.1:g.75358T>G, NM_144701.2:c.1045+41T>G, XR_001736993.1:n.1228+41T>G
                9.

                rs11190140 [Homo sapiens]
                  CATTCAGGCTCCTGATTTCAATAGG[C/T]GGAAAAGAAGGCTGCCAAGGCTGGG
                  Chromosome:
                  10:99531836
                  Gene:
                  LINC01475 (GeneView) NKX2-3 (GeneView)
                  Functional Consequence:
                  upstream variant 2KB
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency
                  Global MAF:
                  T=0.4107/2057
                  HGVS:
                  CM000672.2:g.99531836T>C, NC_000010.10:g.101291593T>C, NC_000010.11:g.99531836T>C, NG_016854.1:g.3904T>C, NM_145285.2:c.-1296T>C, NR_120618.1:n.-659A>G, XR_246177.1:n.-570A>G
                  10.

                  rs11175593 [Homo sapiens]
                    GGAGCCCAAATTCAATTCACCTAAA[C/T]GGGAAAAGTGCAAATATAACAAAGG
                    Chromosome:
                    12:40208138
                    Gene:
                    LOC105369735 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by cluster,by frequency,by hapmap
                    Global MAF:
                    T=0.0497/249
                    HGVS:
                    CM000674.2:g.40208138C>T, NC_000012.11:g.40601940C>T, NC_000012.12:g.40208138C>T, XR_944865.2:n.521+141C>T
                    11.

                    rs10995271 [Homo sapiens]
                      CTCCAGTCACCAGCTAACTCATGCT[C/G]TCTCTCAGGTCTCAGATGAAATGCA
                      Chromosome:
                      10:62678726
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency
                      Global MAF:
                      C=0.3203/1604
                      HGVS:
                      CM000672.2:g.62678726G>C, NC_000010.10:g.64438486G>C
                      12.

                      rs10800309 [Homo sapiens]
                        AGCATCTCTTTAGCTCTGTTTCAAT[A/G/T]GTAAATCCCTCCAACGTGCCAGTCT
                        Chromosome:
                        1:161502368
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        A=0.4391/2199
                        HGVS:
                        CM000663.2:g.161502368A>G, CM000663.2:g.161502368A>T, NC_000001.10:g.161472158A>G, NC_000001.11:g.161502368A>G, NC_000001.11:g.161502368A>T, NG_012066.1:g.1954A>G, NG_012066.2:g.1954A>G, NG_012066.2:g.1954A>T
                        13.

                        rs10758669 [Homo sapiens]
                          TAGAGACAAGGACATGCTGAAGTAC[A/C/T]GAGGAGGTATTGGAAAATTTCTTTG
                          Chromosome:
                          9:4981602
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          C=0.3161/1583
                          HGVS:
                          CM000671.2:g.4981602C>A, CM000671.2:g.4981602C>T, NC_000009.11:g.4981602C>A, NC_000009.12:g.4981602C>A, NC_000009.12:g.4981602C>T, NG_009904.1:g.1358C>A, NG_009904.1:g.1358C>T
                          14.

                          rs10045431 [Homo sapiens]
                            tggcctgagggcaggcacagcccag[A/C]attaaactctcaaattgatgccttg
                            Chromosome:
                            5:159387525
                            Validated:
                            by 1000G,by cluster,by frequency,by hapmap
                            Global MAF:
                            A=0.1508/755
                            HGVS:
                            CM000667.2:g.159387525A>C, NC_000005.9:g.158814533A>C
                            15.

                            rs9286879 [Homo sapiens]
                              GGGAGGAATGAAAATAGAAGCATAT[A/G]TTGAGGGACTACTCCAGGGGAAGAG
                              Chromosome:
                              1:172893094
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency
                              Global MAF:
                              G=0.4748/2378
                              HGVS:
                              CM000663.2:g.172893094A>G, NC_000001.10:g.172862234A>G
                              16.

                              rs8098673 [Homo sapiens]
                                ATGTTAGAAATCCTCTCACTTGTAT[A/C]GTTATTTTTGGCGAAGTCCTTTTGA
                                Chromosome:
                                18:22093370
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency
                                Global MAF:
                                C=0.4722/2365
                                HGVS:
                                CM000680.2:g.22093370A>C, NC_000018.9:g.19673331A>C
                                17.

                                rs8067378 [Homo sapiens]
                                  AAAAAATATTTGTAACGTTATAAAT[A/G]GGGAAAAACGTTTATATCACTGCCA
                                  Chromosome:
                                  17:39895095
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency
                                  Global MAF:
                                  G=0.4315/2161
                                  HGVS:
                                  CM000679.2:g.39895095A>G, NC_000017.10:g.38051348A>G
                                  18.

                                  rs7927894 [Homo sapiens]
                                    GAGGGAGGAGGATAGAGTTTTGAAT[C/T]GGGCATTTGATGTGTATGAAGTCAC
                                    Chromosome:
                                    11:76590272
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency
                                    Global MAF:
                                    T=0.3015/1510
                                    HGVS:
                                    CM000673.2:g.76590272C>T, NC_000011.9:g.76301316C>T
                                    19.

                                    rs7758080 [Homo sapiens]
                                      GTATACTTCCAAGAGGGCAGGAAAA[A/G]GGAGAAAAAGAGAGAGCATGTCATG
                                      Chromosome:
                                      6:149255943
                                      Gene:
                                      LOC105378049 (GeneView) TAB2-AS1 (GeneView) TAB2 (GeneView)
                                      Functional Consequence:
                                      intron variant
                                      Validated:
                                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                      Global MAF:
                                      G=0.3421/1713
                                      HGVS:
                                      CM000668.2:g.149255943A>G, NC_000006.11:g.149577079A>G, NC_000006.12:g.149255943A>G, NG_021386.2:g.43020A>G, NM_001292035.2:c.6+37167A>G, NR_149096.1:n.168+1441T>C, XR_001744409.1:n.185-603T>C, XR_001744410.1:n.185-603T>C, XR_001744411.1:n.184+1441T>C, XR_001744413.1:n.185-603T>C, XR_001744414.1:n.185-603T>C, XR_943103.1:n.185-603T>C, XR_943104.1:n.185-603T>C
                                      20.

                                      rs7746082 [Homo sapiens]
                                        TCTATGTTATATGCCAAGAACTTTT[A/C/G]ATGGCCTCAGAGAAGCAGTACATAC
                                        Chromosome:
                                        6:105987394
                                        Validated:
                                        by 1000G,by 2hit 2allele,by cluster,by frequency
                                        Global MAF:
                                        C=0.1138/570
                                        HGVS:
                                        CM000668.2:g.105987394G>A, CM000668.2:g.105987394G>C, NC_000006.11:g.106435269G>C

                                        Display Settings:

                                        Format
                                        Items per page
                                        Sort by

                                        Send to:

                                        Choose Destination

                                        Supplemental Content

                                        Find related data

                                        Recent activity

                                        Your browsing activity is empty.

                                        Activity recording is turned off.

                                        Turn recording back on

                                        See more...
                                        Support Center