Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 147

4.

rs17383790 [Homo sapiens]
    CAAACTGATCCTGCCCAAGAATTCA[C/T]TTGACTATACCAGGGTGCAGAAATA
    Chromosome:
    4:11318787
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.1458/730
    HGVS:
    NC_000004.11:g.11320411T>C, NC_000004.12:g.11318787T>C
    5.

    rs17114247 [Homo sapiens]
      TGCGACCCGTCTGAGCCTTGAATGT[C/T]GGAATGAAGTGTTTTGCTGCTGGTC
      Chromosome:
      21:42058026
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.1528/765
      HGVS:
      NC_000021.8:g.43478135C>T, NC_000021.9:g.42058026C>T
      6.

      rs17085505 [Homo sapiens]
        TTCAAGTACCATTTGTTATTTCCAA[A/C/T]CTGCCTCTTTGAGAGAATGAGGAAG
        Chromosome:
        18:72076229
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.0415/208
        HGVS:
        NC_000018.10:g.72076229A>C, NC_000018.10:g.72076229A>T, NC_000018.9:g.69743464A>C
        8.

        rs16953659 [Homo sapiens]
          GAGCTGTTAGTTTTAAACTGGACAC[A/G]TCAACTTGGAAAGTTTTGGATTTGC
          Chromosome:
          16:54553520
          Gene:
          LOC105371273 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.0387/194
          HGVS:
          NC_000016.10:g.54553520A>G, NC_000016.9:g.54587432A>G, XR_933595.2:n.202+2487T>C
          10.
          12.

          rs12882384 [Homo sapiens]
            tgctgattttctgtctgcttgtttt[A/C/G]tcagttactgagagaggattatgga
            Chromosome:
            14:93519101
            Gene:
            UNC79 (GeneView)
            Functional Consequence:
            intron variant,utr variant 5 prime
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.3708/1857
            HGVS:
            NC_000014.8:g.93985447A>G, NC_000014.9:g.93519101A>C, NC_000014.9:g.93519101A>G, NG_051662.1:g.190883A>C, NG_051662.1:g.190883A>G, NM_001346218.1:c.899-4877A>C, NM_001346218.1:c.899-4877A>G, NM_020818.3:c.368-4877A>G, NM_020818.4:c.368-4877A>C, NM_020818.4:c.368-4877A>G, NT_187601.1:g.633663A>C, NT_187601.1:g.633663A>G, XM_005267917.1:c.902-4877A>G, XM_011537018.2:c.1034-4877A>C, XM_011537018.2:c.1034-4877A>G, XM_011537020.2:c.1034-4877A>C, XM_011537020.2:c.1034-4877A>G, XM_011537021.2:c.899-4877A>C, XM_011537021.2:c.899-4877A>G, XM_011537022.2:c.1034-4877A>C, XM_011537022.2:c.1034-4877A>G, XM_011537023.2:c.875-4877A>C, XM_011537023.2:c.875-4877A>G, XM_011537024.2:c.1034-4877A>C, XM_011537024.2:c.1034-4877A>G, XM_011537025.2:c.1034-4877A>C, XM_011537025.2:c.1034-4877A>G, XM_011537026.2:c.698-4877A>C, XM_011537026.2:c.698-4877A>G, XM_011537027.2:c.698-4877A>C, XM_011537027.2:c.698-4877A>G, XM_011537028.2:c.368-4877A>C, XM_011537028.2:c.368-4877A>G, XM_017021506.1:c.1034-4877A>C, XM_017021506.1:c.1034-4877A>G, XM_017021507.1:c.1034-4877A>C, XM_017021507.1:c.1034-4877A>G, XM_017021508.1:c.1034-4877A>C, XM_017021508.1:c.1034-4877A>G, XM_017021509.1:c.1034-4877A>C, XM_017021509.1:c.1034-4877A>G, XM_017021510.1:c.1034-4877A>C, XM_017021510.1:c.1034-4877A>G, XM_017021511.1:c.182-4877A>C, XM_017021511.1:c.182-4877A>G, XM_017021512.1:c.899-4877A>C, XM_017021512.1:c.899-4877A>G, XM_017021513.1:c.1034-4877A>C, XM_017021513.1:c.1034-4877A>G, XM_017021514.1:c.1034-4877A>C, XM_017021514.1:c.1034-4877A>G, XM_017021515.1:c.740-4877A>C, XM_017021515.1:c.740-4877A>G, XM_017021516.1:c.1034-4877A>C, XM_017021516.1:c.1034-4877A>G, XM_017021517.1:c.875-4877A>C, XM_017021517.1:c.875-4877A>G, XM_017021518.1:c.-1256A>C, XM_017021518.1:c.-1256A>G
            13.

            rs12805648 [Homo sapiens]
              CTTCGAGAGGCTGACGAGTGCATCG[A/T]ATCAGAGGACAAGACACTGGCAGAA
              Chromosome:
              11:7488335
              Gene:
              OLFML1 (GeneView)
              Functional Consequence:
              missense
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.1663/833
              HGVS:
              NC_000011.10:g.7488335A>T, NC_000011.9:g.7509566A>T, NM_198474.3:c.338A>T, NP_940876.2:p.Glu113Val, XM_005252878.1:c.338A>T, XM_005252878.4:c.338A>T, XP_005252935.1:p.Glu113Val
              14.

              rs12800641 [Homo sapiens]
                TGGGGTGGGAGGTGGGGTGGGGATC[A/G]GGGGGAGGACAAGCATGCAATCTAC
                Chromosome:
                11:74442195
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.1909/956
                HGVS:
                NC_000011.10:g.74442195G>A, NC_000011.9:g.74153240G>A
                15.
                16.

                rs12700284 [Homo sapiens]
                  GCCCCAAATAATTAGTCTTTCTTAA[G/T]TGGCTGGTTCCAGGTGGTAGGTTTC
                  Chromosome:
                  7:21407271
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  T=0.2129/1066
                  HGVS:
                  NC_000007.13:g.21446889G>T, NC_000007.14:g.21407271G>T
                  17.

                  rs12667392 [Homo sapiens]
                    TTTACAAATTTAAAGGTGTTTTGTA[A/C]AATGGTTGTCTTTTGACAAATGAGC
                    Chromosome:
                    7:6112051
                    Gene:
                    USP42 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by cluster,by frequency,by hapmap
                    Global MAF:
                    C=0.0813/407
                    HGVS:
                    NC_000007.13:g.6151682A>C, NC_000007.14:g.6112051A>C, NM_032172.2:c.241+677A>C, XM_005249882.1:c.241+677A>C, XM_005249883.1:c.241+677A>C, XM_005249883.4:c.241+677A>C, XM_006715790.1:c.241+677A>C, XM_006715791.2:c.241+677A>C, XM_011515573.1:c.241+677A>C, XM_011515574.1:c.-184+677A>C, XM_011515578.1:c.-367+677A>C
                    18.

                    rs12634193 [Homo sapiens]
                      tcaagacttgagatttttttcttga[C/T]gtaatctgaaggattaagagaactg
                      Chromosome:
                      3:171462896
                      Gene:
                      LOC102724479 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      T=0.2294/1149
                      HGVS:
                      NC_000003.11:g.171180685T>C, NC_000003.12:g.171462896T>C, XR_001740531.1:n.863+1539T>C, XR_924707.2:n.863+1539T>C
                      19.

                      rs12587874 [Homo sapiens]
                        ATTTAAAAAGAGCAAAGAAATGTAG[A/G]TTAGATCAAAATTTGCCTGGGTTTA
                        Chromosome:
                        14:28984835
                        Gene:
                        LOC105370425 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by cluster,by frequency,by hapmap
                        Global MAF:
                        G=0.2198/1101
                        HGVS:
                        NC_000014.8:g.29454041A>G, NC_000014.9:g.28984835A>G, XR_001750704.1:n.302-5817T>C, XR_001750705.1:n.80-5817T>C, XR_943695.2:n.256-5817T>C, XR_943697.2:n.120-5817T>C, XR_943698.2:n.1479-5817T>C

                        Display Settings:

                        Format
                        Items per page
                        Sort by

                        Send to:

                        Choose Destination

                        Supplemental Content

                        Find related data

                        Recent activity

                        Your browsing activity is empty.

                        Activity recording is turned off.

                        Turn recording back on

                        See more...
                        Support Center