Display Settings:

Format

Send to:

Choose Destination

Links from

1.

rs17647532 [Homo sapiens]
    CTAGTTGCCTAACCCCCTATGGTAA[C/T]TAATAGCTTGACTTTTACCTTAACG
    Chromosome:
    18:35654108
    Gene:
    GALNT1 (GeneView)
    Functional Consequence:
    intron variant,upstream variant 2KB
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.0988/495
    HGVS:
    NC_000018.10:g.35654108T>C, NC_000018.9:g.33234072T>C, NM_020474.3:c.-555T>C, XM_005258239.1:c.-103-452T>C, XM_005258239.3:c.-103-452T>C, XM_017025692.1:c.-103-452T>C

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center