Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs5745752 [Homo sapiens]
    ATGCTGTATATATATGTATATATGC[A/G]TGCGTTTGGGTCTCTCTGTGAGTAT
    Chromosome:
    7:81706144
    Gene:
    HGF (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.2698/1351
    HGVS:
    NC_000007.13:g.81335460C>T, NC_000007.14:g.81706144C>T, NG_016274.2:g.68993G>A, NM_000601.5:c.1757+143G>A, NM_001010932.2:c.1742+143G>A, XM_006715956.2:c.1757+143G>A, XM_011516115.2:c.1742+143G>A

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center