Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from

Items: 15

1.

rs12296050 [Homo sapiens]
    AAATGCACTGTCTCTCCTGGGCTCC[C/T]AACCTTTCACAGGCCACAGGCCCAT
    Chromosome:
    11:2468112
    Gene:
    KCNQ1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.3990/1998
    HGVS:
    NC_000011.10:g.2468112C>T, NC_000011.9:g.2489342C>T, NG_008935.1:g.28122C>T, NM_000218.2:c.386+22628C>T, NM_181798.1:c.5+6398C>T, NR_040711.2:n.279+6398C>T
    2.

    rs12053903 [Homo sapiens]
      GGCCAGAGGGGATCTGCTTAGTATC[C/T]TGCCCACCCAGCTTGGGCCAGAACT
      Chromosome:
      3:38551902
      Gene:
      SCN5A (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.4579/2293
      HGVS:
      NC_000003.11:g.38593393T>C, NC_000003.12:g.38551902T>C, NG_008934.1:g.102771A>G, NM_000335.4:c.4811-344A>G, NM_001099404.1:c.4814-344A>G, NM_001099405.1:c.4760-344A>G, NM_001160160.1:c.4715-344A>G, NM_001160161.1:c.4652-344A>G, NM_198056.2:c.4814-344A>G, XM_011533991.2:c.4811-344A>G, XM_017007017.1:c.4652-344A>G
      3.

      rs11970286 [Homo sapiens]
        ctgaggccaaaggcatgagaactag[C/T]gaatgggaggaggagtgaaggtagg
        Chromosome:
        6:118359211
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.2927/1466
        HGVS:
        NC_000006.11:g.118680374C>T, NC_000006.12:g.118359211C>T
        4.

        rs11129795 [Homo sapiens]
          TATTATATGATTCCACTTATATAAG[A/G]CATTTAGGGTAGTTGAATTTGTCAA
          Chromosome:
          3:38547672
          Gene:
          SCN5A (GeneView)
          Functional Consequence:
          downstream variant 500B
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.1771/887
          HGVS:
          NC_000003.11:g.38589163G>A, NC_000003.12:g.38547672G>A, NG_008934.1:g.107001C>T, NM_000335.4:c.*2649C>T, NM_001099404.1:c.*2649C>T, NM_001099405.1:c.*2649C>T, NM_001160160.1:c.*2649C>T, NM_001160161.1:c.*2649C>T, NM_198056.2:c.*2649C>T, XM_011533991.2:c.*2649C>T, XM_017007017.1:c.*2649C>T
          5.

          rs10494366 [Homo sapiens]
            TCAGATATTTATGGGAGGTATGCAG[G/T]TTTTAAATTCTGAGAATTTGTACTG
            Chromosome:
            1:162115895
            Gene:
            LOC105371475 (GeneView) NOS1AP (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.4157/2082
            HGVS:
            NC_000001.10:g.162085685G>T, NC_000001.11:g.162115895G>T, NG_015979.1:g.51105G>T, NM_001164757.1:c.106-38510G>T, NM_014697.2:c.106-38510G>T, XR_001738271.1:n.594-1993C>A, XR_001738272.1:n.1462-1993C>A
            6.

            rs7660702 [Homo sapiens]
              ATTCAGTCCACACAAATTCAGGGAG[C/T]TATTTACAAATATTCTGAGATTGAA
              Chromosome:
              4:85730311
              Gene:
              ARHGAP24 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.3890/1948
              HGVS:
              NC_000004.11:g.86651464T>C, NC_000004.12:g.85730311T>C, NG_051627.1:g.260181T>C, NM_001025616.2:c.268+8339T>C, XM_005263263.1:c.268+8339T>C, XM_005263264.1:c.268+8339T>C
              8.

              rs3825214 [Homo sapiens]
                GTTGCAGGGCTAACACCACCAGTCA[A/G]GCTCATGGCAGACATAATTCACAAT
                Chromosome:
                12:114357638
                Gene:
                TBX5 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                G=0.2959/1482
                HGVS:
                NC_000012.11:g.114795443G>A, NC_000012.12:g.114357638G>A, NG_007373.1:g.55805C>T, NM_000192.3:c.983-1532C>T, NM_080717.2:c.833-1532C>T, NM_181486.2:c.983-1532C>T, XM_017019912.1:c.1031-1532C>T
                9.

                rs3807989 [Homo sapiens]
                  TTGTTTGGTAACACTCAACATCAAC[A/G]TGTGCTACCAAATTGACACCAGAGG
                  Chromosome:
                  7:116546187
                  Gene:
                  CAV1 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  A=0.4399/2203
                  HGVS:
                  NC_000007.13:g.116186241A>G, NC_000007.14:g.116546187A>G, NG_012051.1:g.26403A>G, NM_001172895.1:c.103-12759A>G, NM_001172896.1:c.103-12759A>G, NM_001172897.1:c.103-12759A>G, NM_001753.4:c.196-12759A>G
                  10.

                  rs3807375 [Homo sapiens]
                    CCCTTAGAGAACTTCTGCGTTTAGA[A/G]TGCTCCTTTTTCCTTAAAAACACGT
                    Chromosome:
                    7:150970122
                    Gene:
                    KCNH2 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    C=0.4273/2140
                    HGVS:
                    NC_000007.13:g.150667210C>T, NC_000007.14:g.150970122C>T, NG_008916.1:g.12805G>A, NM_000238.3:c.307+4589G>A, NM_172056.2:c.307+4589G>A, XM_011516185.2:c.7+4248G>A, XM_011516186.2:c.307+4589G>A, XM_017012196.1:c.130+4589G>A
                    11.

                    rs1733724 [Homo sapiens]
                      AGGATTTTCTGCTACTTCTCTTCCA[C/T]ACTGAGGCTACAGGTACTTTGCCAG
                      Chromosome:
                      10:52464217
                      Gene:
                      LINC01468 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by cluster,by frequency,by hapmap,by submitter
                      Global MAF:
                      A=0.1322/662
                      HGVS:
                      NC_000010.10:g.54223977A>G, NC_000010.11:g.52464217A>G, NR_120641.1:n.138-885T>C
                      12.

                      rs1321311 [Homo sapiens]
                        caaatgggagcaagggagtgagtga[G/T]tgaggcttccgtgattccaccctag
                        Chromosome:
                        6:36655123
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                        Global MAF:
                        A=0.2764/1384
                        HGVS:
                        NC_000006.11:g.36622900C>A, NC_000006.12:g.36655123C>A
                        13.

                        rs727957 [Homo sapiens]
                          CCCAGTGACTTAGCAACCGTGGCAT[G/T]CTTCTGCAAACATTTCAAAGACCTC
                          Chromosome:
                          21:34507774
                          Gene:
                          KCNE1 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by cluster,by frequency,by hapmap,by submitter
                          Global MAF:
                          T=0.0950/476
                          HGVS:
                          NC_000021.8:g.35880072G>T, NC_000021.9:g.34507774G>T, NG_009091.1:g.8542C>A, NM_000219.3:c.-162+3327C>A, NM_000219.5:c.-162+3327C>A, NM_001270402.2:c.-162+3327C>A, NM_001270403.2:c.-134+3327C>A, NM_001270404.2:c.-51+3327C>A
                          14.

                          rs365990 [Homo sapiens]
                            TTTCTTCTGTAGTTGAAGGGCCAGC[A/G]CCTGCTCATCCTCAATCTTACTGTT
                            Chromosome:
                            14:23392602
                            Gene:
                            MYH6 (GeneView)
                            Functional Consequence:
                            missense
                            Clinical significance:
                            Likely benign
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                            Global MAF:
                            G=0.3748/1877
                            HGVS:
                            NC_000014.8:g.23861811A>G, NC_000014.9:g.23392602A>G, NG_023444.1:g.20676T>C, NM_002471.3:c.3302T>C, NP_002462.2:p.Val1101Ala, XM_005267694.1:c.3422T>C, XM_005267695.1:c.2805+1466T>C, XP_005267751.1:p.Val1141Ala
                            15.

                            rs37062 [Homo sapiens]
                              aggcgggtcacttgagggacccaat[A/G]gggttaagaaccactgacgtggccg
                              Chromosome:
                              16:58533334
                              Gene:
                              CNOT1 (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              G=0.2837/1421
                              HGVS:
                              NC_000016.10:g.58533334A>G, NC_000016.9:g.58567238A>G, NM_001265612.1:c.5880+813T>C, NM_016284.4:c.5895+813T>C, NR_049763.1:n.6213+813T>C, XM_005255845.1:c.5916+813T>C, XM_005255846.1:c.5916+813T>C, XM_005255847.1:c.5913+813T>C, XM_005255848.1:c.5901+813T>C, XM_005255849.1:c.5892+813T>C, XM_005255850.1:c.5799+813T>C, XM_005255851.1:c.5778+813T>C, XR_243400.1:n.6194+813T>C

                              Display Settings:

                              Format
                              Items per page
                              Sort by

                              Send to:

                              Choose Destination

                              Supplemental Content

                              Find related data

                              Recent activity

                              Your browsing activity is empty.

                              Activity recording is turned off.

                              Turn recording back on

                              See more...
                              Support Center