Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 8

1.

rs12720462 [Homo sapiens]
    AAGCCAGCACTGGCTCATACTGATT[A/C]ATTTTGATCTCTGCTAATACCAGAG
    Chromosome:
    1:171248552
    Gene:
    FMO1 (GeneView) LOC105371611 (GeneView)
    Functional Consequence:
    intron variant,utr variant 5 prime
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.1803/903
    HGVS:
    NC_000001.10:g.171217691C>A, NC_000001.11:g.171248552C>A, NM_001282693.1:c.-78C>A, NM_001282694.1:c.-78C>A, NM_002021.2:c.-69C>A, XM_005245034.1:c.-78C>A, XM_005245035.1:c.-78C>A, XM_005245038.1:c.-78C>A, XM_005245038.3:c.-78C>A, XM_006711241.3:c.-78C>A, XM_006711242.3:c.-78C>A, XR_001738291.1:n.1160-825G>T, XR_922278.2:n.1160-825G>T
    3.

    rs1803274 [Homo sapiens]
      ATATTTTACAGGAAATATTGATGAA[A/G]CAGAATGGGAGTGGAAAGCAGGATT
      Chromosome:
      3:165773492
      Gene:
      BCHE (GeneView)
      Functional Consequence:
      missense,nc transcript variant
      Allele Origin:
      G(germline)/A(germline)
      Clinical significance:
      Likely benign
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.1585/794
      HGVS:
      NC_000003.11:g.165491280C>T, NC_000003.12:g.165773492C>T, NG_009031.1:g.68974G>A, NM_000055.3:c.1699G>A, NP_000046.1:p.Ala567Thr, NR_137635.1:n.341G>A, NR_137636.1:n.1945G>A, XM_005247685.1:c.1822G>A, XM_017006967.1:c.1822G>A, XP_005247742.1:p.Ala608Thr, XP_016862456.1:p.Ala608Thr
      4.

      rs887241 [Homo sapiens]
        TGGCTCGGTGTGCTCTGCAGGGAAC[A/G/T]CAGTGGTCCTCAAGCCCTCGGAGCT
        Chromosome:
        17:19742625
        Gene:
        ALDH3A1 (GeneView)
        Functional Consequence:
        missense
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.2554/1279
        HGVS:
        NC_000017.10:g.19645938A>C, NC_000017.10:g.19645938A>T, NC_000017.11:g.19742625A>C, NC_000017.11:g.19742625A>T, NG_012251.1:g.10809T>A, NG_012251.1:g.10809T>G, NM_000691.4:c.400T>A, NM_000691.4:c.400T>G, NM_001135167.1:c.400T>A, NM_001135167.1:c.400T>G, NM_001135168.1:c.400T>A, NM_001135168.1:c.400T>G, NM_001330150.1:c.181T>A, NM_001330150.1:c.181T>G, NP_000682.3:p.Ser134Ala, NP_000682.3:p.Ser134Thr, NP_001128639.1:p.Ser134Ala, NP_001128639.1:p.Ser134Thr, NP_001128640.1:p.Ser134Ala, NP_001128640.1:p.Ser134Thr, NP_001317079.1:p.Ser61Ala, NP_001317079.1:p.Ser61Thr, XM_005256522.1:c.751T>A, XM_005256522.1:c.751T>G, XM_005256523.1:c.751T>A, XM_005256523.1:c.751T>G, XM_005256523.2:c.751T>A, XM_005256523.2:c.751T>G, XM_005256524.1:c.751T>A, XM_005256524.1:c.751T>G, XM_005256524.3:c.751T>A, XM_005256524.3:c.751T>G, XM_005256525.1:c.751T>A, XM_005256525.1:c.751T>G, XM_005256526.1:c.181T>A, XM_005256526.1:c.181T>G, XM_011523730.1:c.181T>A, XM_011523730.1:c.181T>G, XM_011523731.1:c.181T>A, XM_011523731.1:c.181T>G, XP_005256579.1:p.Ser251Ala, XP_005256579.1:p.Ser251Thr, XP_005256580.1:p.Ser251Ala, XP_005256580.1:p.Ser251Thr, XP_005256581.1:p.Ser251Ala, XP_005256581.1:p.Ser251Thr, XP_005256582.1:p.Ser251Ala, XP_005256582.1:p.Ser251Thr, XP_005256583.1:p.Ser61Ala, XP_005256583.1:p.Ser61Thr, XP_011522032.1:p.Ser61Ala, XP_011522032.1:p.Ser61Thr, XP_011522033.1:p.Ser61Ala, XP_011522033.1:p.Ser61Thr
        5.

        rs854560 [Homo sapiens]
          GCCAGTCCATTAGGCAGTATCTCCA[A/C/G/N/T]GTCTTCAGAGCCAGTTTCTGCCAGA
          Chromosome:
          7:95316772
          Gene:
          PON1 (GeneView)
          Functional Consequence:
          missense
          Allele Origin:
          T(germline)/A(germline)
          Clinical significance:
          other
          Validated:
          by 1000G,by cluster,by frequency
          Global MAF:
          T=0.1827/915
          HGVS:
          NC_000007.13:g.94946084A>T, NC_000007.14:g.95316772A>T, NG_008779.1:g.12801T>A, NM_000446.5:c.163T>A, NP_000437.3:p.Leu55Met
          6.

          rs705379 [Homo sapiens]
            GGGGCAGCGCCGATTGGCCCGCCCC[A/G]CCCCTCCCCGCCGGGTCGGCAGCTA
            Chromosome:
            7:95324583
            Gene:
            PON1 (GeneView)
            Functional Consequence:
            upstream variant 2KB
            Allele Origin:
            G(germline)/A(germline)
            Clinical significance:
            other
            Validated:
            by 1000G,by cluster,by frequency
            Global MAF:
            A=0.3490/1748
            HGVS:
            NC_000007.13:g.94953895G>A, NC_000007.14:g.95324583G>A, NG_008779.1:g.4990C>T, NM_000446.5:c.-108C>T
            8.

            rs662 [Homo sapiens]
              CACTATTTTCTTGACCCCTACTTAC[A/G]ATCCTGGGAGATGTATTTGGGTTTA
              Chromosome:
              7:95308134
              Gene:
              PON1 (GeneView)
              Functional Consequence:
              missense
              Allele Origin:
              G(germline)/A(germline)
              Clinical significance:
              other
              Validated:
              by 1000G,by cluster,by frequency,by hapmap,by submitter
              Global MAF:
              T=0.4571/2289
              HGVS:
              NC_000007.13:g.94937446T>C, NC_000007.14:g.95308134T>C, NG_008779.1:g.21439A>G, NM_000446.5:c.575A>G, NP_000437.3:p.Gln192Arg

              Display Settings:

              Format
              Items per page
              Sort by

              Send to:

              Choose Destination

              Supplemental Content

              Find related data

              Recent activity

              Your browsing activity is empty.

              Activity recording is turned off.

              Turn recording back on

              See more...
              Support Center