Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 5

2.

rs1800896 [Homo sapiens]
    CAACACTACTAAGGCTTCTTTGGGA[A/G]GGGGAAGTAGGGATAGGTAAGAGGA
    Chromosome:
    1:206773552
    Gene:
    IL10 (GeneView)
    Functional Consequence:
    upstream variant 2KB
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.2722/1363
    HGVS:
    NC_000001.10:g.206946897T>C, NC_000001.11:g.206773552T>C, NG_012088.1:g.3943A>G, NM_000572.2:c.-1117A>G
    3.

    rs1800890 [Homo sapiens]
      CCAGTACATCCCCCACTGGAAAAAT[A/T]CATTTAAAATCAGTATAATAAGCAT
      Chromosome:
      1:206776020
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.2063/1033
      HGVS:
      NC_000001.10:g.206949365A>T, NC_000001.11:g.206776020A>T, NG_012088.1:g.1475T>A

      Display Settings:

      Format
      Sort by

      Send to:

      Choose Destination

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center