Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 5

1.

rs12896399 [Homo sapiens]
    GTTCTTTAGGTCAGTATATTTTGGG[G/T]TCTCTTTGTCACAGCAGATTAACCT
    Chromosome:
    14:92307319
    Gene:
    LOC105370627 (GeneView)
    Functional Consequence:
    intron variant
    Allele Origin:
    G(germline)/T(germline)
    Clinical significance:
    other
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    T=0.2608/1306
    HGVS:
    CM000676.2:g.92307319G>T, NC_000014.8:g.92773663G>T, NC_000014.9:g.92307319G>T, XR_944153.1:n.131+2775G>T
    2.

    rs1805007 [Homo sapiens]
      CTACATCTCCATCTTCTACGCACTG[A/C/G/T]GCTACCACAGCATCGTGACCCTGCC
      Chromosome:
      16:89919709
      Gene:
      MC1R (GeneView)
      Functional Consequence:
      missense
      Allele Origin:
      T(germline)/C(germline)
      Clinical significance:
      Pathogenic
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      T=0.0186/93
      HGVS:
      CM000678.2:g.89919709C>T, NC_000016.10:g.89919709C>T, NC_000016.9:g.89986117C>T, NG_012026.1:g.6831C>T, NG_027810.1:g.2701C>T, NM_002386.3:c.451C>T, NP_002377.4:p.Arg151Cys
      3.

      rs1540771 [Homo sapiens]
        CCACACACGTGATAGACTGAGCTCA[A/G/T]CCAACTCGTGCAGTTCATAACACAG
        Chromosome:
        6:466033
        Gene:
        LOC105374875 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
        Global MAF:
        T=0.3227/1616
        HGVS:
        CM000668.2:g.466033C>A, CM000668.2:g.466033C>T, NC_000006.11:g.466033C>T, NC_000006.12:g.466033C>A, NC_000006.12:g.466033C>T, XR_001743914.1:n.482-9175C>A, XR_001743914.1:n.482-9175C>T
        4.
        5.

        rs25531 [Homo sapiens]
          CTCGCGGCATCCCCCCTGCACCCCC[A/G]GCATCCCCCCTGCAGCCCCCCCAGC
          Chromosome:
          17:30237328
          Gene:
          LOC105371720 (GeneView) SLC6A4 (GeneView)
          Functional Consequence:
          intron variant,upstream variant 2KB
          Validated:
          by 1000G,by cluster,by frequency
          Global MAF:
          C=0.1376/689
          HGVS:
          CM000679.2:g.30237328T>C, NC_000017.10:g.28564346T>C, NC_000017.11:g.30237328T>C, NG_011747.2:g.3609A>G, NG_055470.1:g.1948T>C, NM_001045.5:c.-1936A>G, XR_001752824.1:n.280+258T>C

          Display Settings:

          Format
          Sort by

          Send to:

          Choose Destination

          Supplemental Content

          Find related data

          Recent activity

          Your browsing activity is empty.

          Activity recording is turned off.

          Turn recording back on

          See more...
          Support Center