Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs5918 [Homo sapiens]
    GCTCCTGTCTTACAGGCCCTGCCTC[C/T]GGGCTCACCTCGCTGTGACCTGAAG
    Chromosome:
    17:47283364
    Gene:
    ITGB3 (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    T(germline)/C(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.0889/445
    HGVS:
    NC_000017.10:g.45360730T>C, NC_000017.11:g.47283364T>C, NG_008332.2:g.34523T>C, NM_000212.2:c.176T>C, NP_000203.2:p.Leu59Pro

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center