Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 15

1.

rs17508595 [Homo sapiens]
    CTTATTACAGGTAATTGAACAGAAG[C/G]TAGTCAATTAGATTATATACGCACG
    Chromosome:
    2:184618381
    Gene:
    ZNF804A (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.2252/1128
    HGVS:
    NC_000002.11:g.185483108C>G, NC_000002.12:g.184618381C>G, NG_046950.1:g.25016C>G, NM_194250.1:c.111+19311C>G
    2.

    rs13393273 [Homo sapiens]
      AGATCTTTGTGCAACAGCTAGCATT[A/G]TATAAGCTAAATTTGATAAAGTAAG
      Chromosome:
      2:184612950
      Gene:
      ZNF804A (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.3534/1770
      HGVS:
      NC_000002.11:g.185477677A>G, NC_000002.12:g.184612950A>G, NG_046950.1:g.19585A>G, NM_194250.1:c.111+13880A>G
      3.

      rs12693385 [Homo sapiens]
        TCTTTGTATCAACATCTTCATAACC[C/T]GTAATTGTTTTAAAAATTCATTAGT
        Chromosome:
        2:184642502
        Gene:
        ZNF804A (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.4834/2421
        HGVS:
        NC_000002.11:g.185507229C>T, NC_000002.12:g.184642502C>T, NG_046950.1:g.49137C>T, NM_194250.1:c.111+43432C>T
        4.

        rs12613195 [Homo sapiens]
          GTTCTATATTACATTTTTCAGAGCA[C/G]TAGCAATGATTCTATAAAAGACTGA
          Chromosome:
          2:184624494
          Gene:
          ZNF804A (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.2714/1359
          HGVS:
          NC_000002.11:g.185489221C>G, NC_000002.12:g.184624494C>G, NG_046950.1:g.31129C>G, NM_194250.1:c.111+25424C>G
          5.

          rs12477430 [Homo sapiens]
            TTAGTTCTTCAAAATGATATGAAAC[A/G]CATGAGTCAGAATCAGGCTGTTAAA
            Chromosome:
            2:184937636
            Gene:
            ZNF804A (GeneView)
            Functional Consequence:
            missense
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.2957/1481
            HGVS:
            NC_000002.11:g.185802363A>G, NC_000002.12:g.184937636A>G, NG_046950.1:g.344271A>G, NM_194250.1:c.2240A>G, NP_919226.1:p.His747Arg
            7.

            rs7605689 [Homo sapiens]
              TCCTGCACTATCTTTCACGTTTTTG[C/T]CATATGTCCCTGTATGTCTTCTTTA
              Chromosome:
              2:184841129
              Gene:
              ZNF804A (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.2875/1440
              HGVS:
              NC_000002.11:g.185705856T>C, NC_000002.12:g.184841129T>C, NG_046950.1:g.247764T>C, NM_194250.1:c.112-25240T>C
              8.

              rs7603001 [Homo sapiens]
                TTTTATGGTAAAAAAATATGTACTT[A/G]GAATTAGCTAGACTCAGTTTAGCTT
                Chromosome:
                2:184902089
                Gene:
                ZNF804A (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                G=0.4567/2287
                HGVS:
                NC_000002.11:g.185766816A>G, NC_000002.12:g.184902089A>G, NG_010972.1:g.574T>C, NG_046950.1:g.308724A>G, NM_194250.1:c.256-31514A>G
                9.

                rs7597593 [Homo sapiens]
                  ATTTATGAATTTAATTCATTAATGT[C/T]GTAAATAGTATTGCCCGAGAATTGG
                  Chromosome:
                  2:184668853
                  Gene:
                  ZNF804A (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  C=0.4984/2496
                  HGVS:
                  NC_000002.11:g.185533580T>C, NC_000002.12:g.184668853T>C, NG_046950.1:g.75488T>C, NM_194250.1:c.111+69783T>C
                  10.
                  11.

                  rs4667001 [Homo sapiens]
                    CAGTAGTTGTGATTCTGGAAAAAAT[A/G]AGAACACAGGTCAGAGGTATAAAAA
                    Chromosome:
                    2:184937020
                    Gene:
                    ZNF804A (GeneView)
                    Functional Consequence:
                    missense
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    A=0.4902/2455
                    HGVS:
                    NC_000002.11:g.185801747G>A, NC_000002.12:g.184937020G>A, NG_046950.1:g.343655G>A, NM_194250.1:c.1624G>A, NP_919226.1:p.Glu542Lys
                    12.

                    rs4129148 [Homo sapiens]
                      GCTGGAAAAAATGGCCAATGCAACT[C/G]GGTCTGAATTTCTCTCCTGGGTGTC
                      Chromosome:
                      Y:1029445
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency
                      Global MAF:
                      G=0.4475/2241
                      HGVS:
                      NC_000023.10:g.990180C>G, NC_000023.11:g.1029445C>G, NC_000024.10:g.1029445C>G, NC_000024.9:g.940180C>G, NW_003571064.2:g.186303C>G
                      13.

                      rs3931790 [Homo sapiens]
                        GTTCTATCTTTATAAGCCACTTATA[G/T]TCAATCTAGAGAAAGGTAAAATATA
                        Chromosome:
                        2:184898649
                        Gene:
                        ZNF804A (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by cluster,by frequency,by hapmap
                        Global MAF:
                        C=0.1508/755
                        HGVS:
                        NC_000002.11:g.185763376A>C, NC_000002.12:g.184898649A>C, NG_046950.1:g.305284A>C, NM_194250.1:c.255+32137A>C
                        14.

                        rs1480481 [Homo sapiens]
                          GCATTTTCTCATGGGTTTCCACCCC[C/T]GGTAAGTTAGATTAATGTAATTAAa
                          Chromosome:
                          2:184682735
                          Gene:
                          ZNF804A (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                          Global MAF:
                          T=0.4858/2433
                          HGVS:
                          NC_000002.11:g.185547462C>T, NC_000002.12:g.184682735C>T, NG_046950.1:g.89370C>T, NM_194250.1:c.111+83665C>T
                          15.

                          rs1344706 [Homo sapiens]
                            aacactgaaacaaagaatcaaaaac[G/T]atcagaatcaacttcttggatatct
                            Chromosome:
                            2:184913701
                            Gene:
                            ZNF804A (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            C=0.3045/1525
                            HGVS:
                            NC_000002.11:g.185778428A>C, NC_000002.12:g.184913701A>C, NG_046950.1:g.320336A>C, NM_194250.1:c.256-19902A>C

                            Display Settings:

                            Format
                            Items per page
                            Sort by

                            Send to:

                            Choose Destination

                            Supplemental Content

                            Find related data

                            Recent activity

                            Your browsing activity is empty.

                            Activity recording is turned off.

                            Turn recording back on

                            See more...
                            Support Center