Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs11503014 [Homo sapiens]
    AGCTATGGAGATTACTTCCTGGACT[C/G]TGTGTAGGACTTGATGATTGAGAGA
    Chromosome:
    4:46388848
    Gene:
    GABRA2 (GeneView)
    Functional Consequence:
    intron variant,upstream variant 2KB,utr variant 5 prime
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    G=0.2274/1138
    HGVS:
    CM000666.2:g.46388848C>G, NC_000004.11:g.46390865C>G, NC_000004.12:g.46388848C>G, NG_012835.2:g.6192G>C, NM_000807.3:c.-10-132G>C, NM_001114175.2:c.-142G>C, NM_001286827.2:c.-107-132G>C, NM_001330690.1:c.-10-132G>C

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center