Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs5719145 [Anopheles gambiae]
    GTAGGGTGCCGTTCGTTTTGGCGCT[G/T]CCAGTGCCATCGCCGGTGTCGGCCG
    Chromosome:
    2R:15123068
    Gene:
    AgaP_AGAP002084 (GeneView)
    Functional Consequence:
    synonymous codon
    Validated:
    no info

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center