Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 9

1.

rs5756520 [Homo sapiens]
    TTTGTGTAGGGGGTGAAGACACCCC[A/G]ATCCTAGCCTCTGTACCCCATCCTG
    Chromosome:
    22:37112467
    Gene:
    TMPRSS6 (GeneView)
    Functional Consequence:
    upstream variant 2KB
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.4091/2049
    HGVS:
    NC_000022.10:g.37508507G>A, NC_000022.11:g.37112467G>A, NG_012856.2:g.2097C>T, XM_011529987.1:c.-2014C>T
    3.

    rs2413450 [Homo sapiens]
      aacttgaagccagatgttcagtttc[C/T]gaatATGAGGTACCTCCCCCAGCAC
      Chromosome:
      22:37074184
      Gene:
      TMPRSS6 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.4235/2121
      HGVS:
      NC_000022.10:g.37470224T>C, NC_000022.11:g.37074184T>C, NG_012856.2:g.40380A>G, NM_001289000.1:c.1441+426A>G, NM_001289001.1:c.1441+426A>G, NM_153609.3:c.1468+426A>G, XM_005261382.1:c.1468+426A>G, XM_006724162.1:c.1441+426A>G, XM_006724163.2:c.1441+426A>G, XM_011529987.1:c.1441+426A>G, XM_011529988.1:c.1441+426A>G, XM_011529989.1:c.1009+426A>G
      6.

      rs228921 [Homo sapiens]
        cacttgtgacttaacctgtctaata[C/T]ccacatgcaacaaggggtgtggtgg
        Chromosome:
        22:37110836
        Gene:
        TMPRSS6 (GeneView)
        Functional Consequence:
        upstream variant 2KB
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.4123/2065
        HGVS:
        NC_000022.10:g.37506876A>G, NC_000022.11:g.37110836A>G, NG_012856.2:g.3728T>C, NM_001289000.1:c.-1335T>C, NM_001289001.1:c.-1499T>C, XM_006724163.2:c.-1335T>C, XM_011529987.1:c.-383T>C, XM_011529988.1:c.-1499T>C, XM_011529989.1:c.-1335T>C
        7.

        rs228919 [Homo sapiens]
          aaacaagagagccagaagaaaattg[A/C]ttttaataatacattttatttatcc
          Chromosome:
          22:37110673
          Gene:
          TMPRSS6 (GeneView)
          Functional Consequence:
          upstream variant 2KB
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.4107/2057
          HGVS:
          NC_000022.10:g.37506713G>T, NC_000022.11:g.37110673G>T, NG_012856.2:g.3891C>A, NM_001289000.1:c.-1172C>A, NM_001289001.1:c.-1336C>A, XM_006724163.2:c.-1172C>A, XM_011529987.1:c.-220C>A, XM_011529988.1:c.-1336C>A, XM_011529989.1:c.-1172C>A
          8.

          rs228918 [Homo sapiens]
            aatacattttatttatcccatgatc[A/G]ccagtgttatttcaacataaaatca
            Chromosome:
            22:37110640
            Gene:
            TMPRSS6 (GeneView)
            Functional Consequence:
            upstream variant 2KB
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.4127/2067
            HGVS:
            NC_000022.10:g.37506680T>C, NC_000022.11:g.37110640T>C, NG_012856.2:g.3924A>G, NM_001289000.1:c.-1139A>G, NM_001289001.1:c.-1303A>G, XM_006724163.2:c.-1139A>G, XM_011529987.1:c.-187A>G, XM_011529988.1:c.-1303A>G, XM_011529989.1:c.-1139A>G
            9.

            rs198846 [Homo sapiens]
              accggttaccggtcggtggccgggg[A/G]aatgaggacccctggtatagatggt
              Chromosome:
              6:26107235
              Gene:
              HIST1H1T (GeneView)
              Functional Consequence:
              downstream variant 500B
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              A=0.1072/537
              HGVS:
              NC_000006.11:g.26107463A>G, NC_000006.12:g.26107235A>G, NM_005323.3:c.*235T>C

              Display Settings:

              Format
              Items per page
              Sort by

              Send to:

              Choose Destination

              Supplemental Content

              Find related data

              Recent activity

              Your browsing activity is empty.

              Activity recording is turned off.

              Turn recording back on

              See more...
              Support Center