Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 5

3.

rs1800779 [Homo sapiens]
    TGGCCTTTCTCCAGCCCCTCAGATG[A/G]CACAGAACTACAAACCCCAGCATGC
    Chromosome:
    7:150992855
    Gene:
    NOS3 (GeneView)
    Functional Consequence:
    intron variant,upstream variant 2KB
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.2314/1159
    HGVS:
    NC_000007.13:g.150689943G>A, NC_000007.14:g.150992855G>A, NG_011992.1:g.6797G>A, NM_000603.4:c.-51-898G>A, NM_001160109.1:c.-949G>A, NM_001160110.1:c.-949G>A, NM_001160111.1:c.-949G>A, XM_006716002.3:c.-949G>A, XM_017012232.1:c.-949G>A, XM_017012233.1:c.-2489G>A, XM_017012234.1:c.-949G>A
    5.

    rs7830 [Homo sapiens]
      ACTCCCTTCAGGCAGTCCTTTAGTC[A/C]CCAGCCTCACCTTTGCTCTCAATGT
      Chromosome:
      7:151012483
      Gene:
      ATG9B (GeneView) NOS3 (GeneView)
      Functional Consequence:
      intron variant,nc transcript variant,utr variant 3 prime
      Clinical significance:
      Benign
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.3618/1812
      HGVS:
      NC_000007.13:g.150709571G>T, NC_000007.14:g.151012483G>T, NG_011992.1:g.26425G>T, NG_030317.1:g.17017C>A, NM_000603.4:c.3106+11G>T, NM_173681.5:c.*1452C>A, NR_073169.1:n.3566C>A, NR_133652.1:n.4303C>A, XM_017012232.1:c.3106+11G>T, XM_017012233.1:c.2488+11G>T

      Display Settings:

      Format
      Sort by

      Send to:

      Choose Destination

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center