Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs6490121 [Homo sapiens]
    GACTACTCTTTGCAACTGAAATGTA[A/G]ACAGAGATCAGAGAGCAGACTTATT
    Chromosome:
    12:117270390
    Gene:
    NOS1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    G=0.3704/1855
    HGVS:
    CM000674.2:g.117270390G>A, NC_000012.11:g.117708195G>A, NC_000012.12:g.117270390G>A, NG_011991.2:g.96388C>T, NM_000620.4:c.1839+1995C>T, NM_001204213.1:c.831+1995C>T, NM_001204214.1:c.831+1995C>T, NM_001204218.1:c.1839+1995C>T

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center