Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs1800435 [Homo sapiens]
    CACACCCACACAGGTATGGTGTGAA[C/G]CGGCTGGAAGAGATGCTGAGGCCCT
    Chromosome:
    9:113391611
    Gene:
    ALAD (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    G(germline)/C(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.0635/318
    HGVS:
    NC_000009.11:g.116153891C>G, NC_000009.12:g.113391611C>G, NG_008716.1:g.14728G>C, NM_000031.5:c.177G>C, NM_001003945.2:c.264G>C, NM_001317745.1:c.153G>C, NP_000022.3:p.Lys59Asn, NP_001003945.1:p.Lys88Asn, NP_001304674.1:p.Lys51Asn, XM_005251799.1:c.264G>C, XM_011518364.2:c.204G>C, XP_005251856.1:p.Lys88Asn, XP_011516666.1:p.Lys68Asn

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center