Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 4

1.

rs17095290 [Homo sapiens]
    CTATTTTGTTTTCTACTTTCCAGAG[A/T]TCCACATTGATAAATGACAATTTCC
    Chromosome:
    14:97369307
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.0891/446
    HGVS:
    NC_000014.8:g.97835644A>T, NC_000014.9:g.97369307A>T
    2.

    rs12895357 [Homo sapiens]
      TGTGAACTCTGTCCTGATAGGTCCC[C/G]CTGCTGCTGCTGCTGCTGCTGCTGT
      Chromosome:
      14:92071010
      Gene:
      ATXN3 (GeneView)
      Functional Consequence:
      missense,nc transcript variant
      Allele Origin:
      G(germline)/C(germline)
      Clinical significance:
      Likely benign
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      G=0.2760/1382
      HGVS:
      NC_000014.8:g.92537354C>G, NC_000014.9:g.92071010C>G, NG_008198.2:g.40612G>C, NM_001127696.1:c.871G>C, NM_001127697.2:c.763G>C, NM_001164774.1:c.233G>C, NM_001164776.1:c.278G>C, NM_001164777.1:c.113G>C, NM_001164778.1:c.431G>C, NM_001164779.1:c.553G>C, NM_001164780.1:c.379G>C, NM_001164781.1:c.706G>C, NM_001164782.1:c.68G>C, NM_004993.5:c.916G>C, NM_030660.4:c.751G>C, NP_001121168.1:p.Gly291Arg, NP_001121169.2:p.Gly255Arg, NP_001158246.1:p.Gly78Ala, NP_001158248.1:p.Gly93Ala, NP_001158249.1:p.Gly38Ala, NP_001158250.1:p.Gly144Ala, NP_001158251.1:p.Gly185Arg, NP_001158252.1:p.Gly127Arg, NP_001158253.1:p.Gly236Arg, NP_001158254.1:p.Gly23Ala, NP_004984.2:p.Gly306Arg, NP_109376.1:p.Gly251Arg, NR_028453.1:n.899G>C, NR_028454.1:n.734G>C, NR_028455.1:n.953G>C, NR_028456.1:n.788G>C, NR_028457.1:n.1044G>C, NR_028458.1:n.888G>C, NR_028459.1:n.1039G>C, NR_028460.1:n.414G>C, NR_028461.1:n.897G>C, NR_028462.1:n.876G>C, NR_028463.1:n.588G>C, NR_028464.1:n.886G>C, NR_028465.1:n.908G>C, NR_028466.1:n.534G>C, NR_028467.1:n.900G>C, NR_028468.1:n.732G>C, NR_028469.1:n.746G>C, NR_028470.1:n.204G>C, NR_031765.1:n.401G>C, XM_005267652.1:c.916G>C, XM_005267653.1:c.913G>C, XM_005267654.1:c.871G>C, XM_005267655.1:c.907G>C, XM_005267656.1:c.763G>C, XM_005267657.1:c.751G>C, XM_005267658.1:c.718G>C, XM_005267659.1:c.706G>C, XM_005267660.1:c.*60G>C, XM_005267661.1:c.622G>C, XM_005267662.1:c.622G>C, XM_005267663.1:c.622G>C, XM_005267664.1:c.622G>C, XM_005267665.1:c.598G>C, XM_005267666.1:c.553G>C, XM_005267667.1:c.*52G>C, XM_005267668.1:c.*60G>C, XM_005267669.1:c.*60G>C, XM_005267670.1:c.379G>C, XM_005267671.1:c.379G>C, XM_005267672.1:c.379G>C, XM_005267673.1:c.379G>C, XM_005267674.1:c.379G>C, XM_005267675.1:c.379G>C, XM_005267676.1:c.379G>C, XM_005267677.1:c.379G>C, XM_005267678.1:c.379G>C, XM_005267679.1:c.379G>C, XM_005267680.1:c.379G>C, XM_005267681.1:c.379G>C, XP_005267709.1:p.Gly306Arg, XP_005267710.1:p.Gly305Arg, XP_005267711.1:p.Gly291Arg, XP_005267712.1:p.Gly303Arg, XP_005267713.1:p.Gly255Arg, XP_005267714.1:p.Gly251Arg, XP_005267715.1:p.Gly240Arg, XP_005267716.1:p.Gly236Arg, XP_005267718.1:p.Gly208Arg, XP_005267719.1:p.Gly208Arg, XP_005267720.1:p.Gly208Arg, XP_005267721.1:p.Gly208Arg, XP_005267722.1:p.Gly200Arg, XP_005267723.1:p.Gly185Arg, XP_005267727.1:p.Gly127Arg, XP_005267728.1:p.Gly127Arg, XP_005267729.1:p.Gly127Arg, XP_005267730.1:p.Gly127Arg, XP_005267731.1:p.Gly127Arg, XP_005267732.1:p.Gly127Arg, XP_005267733.1:p.Gly127Arg, XP_005267734.1:p.Gly127Arg, XP_005267735.1:p.Gly127Arg, XP_005267736.1:p.Gly127Arg, XP_005267737.1:p.Gly127Arg, XP_005267738.1:p.Gly127Arg, XR_245685.1:n.765G>C

      Display Settings:

      Format
      Sort by

      Send to:

      Choose Destination

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center