Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 13

2.
5.

rs6483327 [Homo sapiens]
    AAGCACTAGTTTTTTAGGATGGTTG[A/G]TAGATTTTACCAAAAAAGGTATCTC
    Chromosome:
    11:94370301
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.3552/1779
    HGVS:
    NC_000011.10:g.94370301G>A, NC_000011.9:g.94103467G>A
    6.

    rs4988340 [Homo sapiens]
      TTCCCTCCAGACAGGCAAGTCGGAG[A/G]GAAGTCCACGGAAAGGGCTTGAGTT
      Chromosome:
      17:61863272
      Gene:
      BRIP1 (GeneView)
      Functional Consequence:
      intron variant,utr variant 5 prime
      Allele Origin:
      G(germline)/A(germline)
      Clinical significance:
      Likely benign
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.2891/1448
      HGVS:
      NC_000017.10:g.59940633C>T, NC_000017.11:g.61863272C>T, NG_007409.2:g.5288G>A, NM_032043.2:c.-31+12G>A, XM_011525332.2:c.-31+12G>A, XM_011525333.2:c.-27+12G>A, XM_011525334.2:c.-1393G>A, XM_011525335.2:c.-31+12G>A, XM_011525336.2:c.-31+12G>A, XM_011525337.2:c.-31+12G>A, XM_011525339.2:c.-31+12G>A, XM_011525340.2:c.-31+12G>A, XM_011525341.2:c.-31+12G>A
      7.

      rs2619681 [Homo sapiens]
        ttctgctggttacacagtaatgtct[C/T]aatgtgattttaattttcctgatta
        Chromosome:
        15:40696823
        Gene:
        RAD51-AS1 (GeneView) RAD51 (GeneView)
        Functional Consequence:
        intron variant,upstream variant 2KB
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.3520/1763
        HGVS:
        NC_000015.10:g.40696823T>C, NC_000015.9:g.40989021T>C, NG_012120.1:g.6663T>C, NM_001164269.1:c.-3+1502T>C, NM_001164270.1:c.-3+1398T>C, NM_002875.4:c.-3+1398T>C, NM_133487.3:c.-3+1398T>C, NR_040058.1:n.-1718A>G, XM_006720626.3:c.-3+963T>C, XM_011521857.2:c.-2-1934T>C, XM_011521858.2:c.-3+1197T>C, XM_011521859.2:c.-3+958T>C, XM_011521860.2:c.-3+1502T>C, XM_011521861.2:c.-2-1934T>C, XM_011521862.2:c.-257+1398T>C
        8.

        rs2619680 [Homo sapiens]
          TTGTTTGTTTTTAACTTCTAAAGCG[A/C]AATGTAATATACATGTAGAAAAATT
          Chromosome:
          15:40696220
          Gene:
          RAD51-AS1 (GeneView) RAD51 (GeneView)
          Functional Consequence:
          intron variant,upstream variant 2KB
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by submitter
          Global MAF:
          A=0.4435/2221
          HGVS:
          NC_000015.10:g.40696220C>A, NC_000015.9:g.40988418C>A, NG_012120.1:g.6060C>A, NM_001164269.1:c.-3+899C>A, NM_001164270.1:c.-3+795C>A, NM_002875.4:c.-3+795C>A, NM_133487.3:c.-3+795C>A, NR_040058.1:n.-1115G>T, XM_006720626.3:c.-3+360C>A, XM_011521857.2:c.-3+1400C>A, XM_011521858.2:c.-3+594C>A, XM_011521859.2:c.-3+355C>A, XM_011521860.2:c.-3+899C>A, XM_011521861.2:c.-3+1400C>A, XM_011521862.2:c.-257+795C>A
          9.

          rs1805794 [Homo sapiens]
            ATTTGTGGAGGCTGCTTCTTGGACT[C/G]AACTGCTTTCAGGAATTCAGTAAAA
            Chromosome:
            8:89978251
            Gene:
            NBN (GeneView)
            Functional Consequence:
            intron variant,missense,utr variant 5 prime
            Allele Origin:
            G(germline)/C(germline)
            Clinical significance:
            Benign
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
            Global MAF:
            G=0.3570/1788
            HGVS:
            NC_000008.10:g.90990479C>G, NC_000008.11:g.89978251C>G, NG_008860.1:g.11421G>C, NM_001024688.2:c.307G>C, NM_002485.4:c.553G>C, NP_001019859.1:p.Glu103Gln, NP_002476.2:p.Glu185Gln, XM_005250923.1:c.307G>C, XM_011517045.1:c.307G>C, XM_011517046.1:c.553G>C, XM_017013460.1:c.-327G>C, XM_017013461.1:c.-296+2483G>C, XM_017013462.1:c.-296+2483G>C, XP_005250980.1:p.Glu103Gln, XP_011515347.1:p.Glu103Gln, XP_011515348.1:p.Glu185Gln, XR_242390.1:n.690G>C, XR_242391.1:n.766G>C
            10.

            rs1801320 [Homo sapiens]
              GAGTAGAGAAGTGGAGCGTAAGCCA[C/G]GGGCGTTGGGGGCCGTGCGGGTCGG
              Chromosome:
              15:40695330
              Gene:
              RAD51-AS1 (GeneView) RAD51 (GeneView)
              Functional Consequence:
              intron variant,upstream variant 2KB,utr variant 5 prime
              Clinical significance:
              other
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.1432/717
              HGVS:
              NC_000015.10:g.40695330G>C, NC_000015.9:g.40987528G>C, NG_012120.1:g.5170G>C, NM_001164269.1:c.-3+9G>C, NM_001164270.1:c.-98G>C, NM_002875.4:c.-98G>C, NM_133487.3:c.-98G>C, NR_040058.1:n.-225C>G, XM_006720626.3:c.-533G>C, XM_011521857.2:c.-3+510G>C, XM_011521858.2:c.-299G>C, XM_011521859.2:c.-538G>C, XM_011521860.2:c.-3+9G>C, XM_011521861.2:c.-3+510G>C, XM_011521862.2:c.-352G>C
              11.

              Display Settings:

              Format
              Items per page
              Sort by

              Send to:

              Choose Destination

              Supplemental Content

              Find related data

              Recent activity

              Your browsing activity is empty.

              Activity recording is turned off.

              Turn recording back on

              See more...
              Support Center