Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

1.

rs7590720 [Homo sapiens]
    TTGGCTGTCTTAAAACATGGGCTCA[A/G]TAATCGCTAGTTTTGACGTAGCATA
    Chromosome:
    2:216033935
    Gene:
    PECR (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.2839/1422
    HGVS:
    CM000664.2:g.216033935G>A, NC_000002.11:g.216898658G>A, NC_000002.12:g.216033935G>A, XR_001738847.1:n.1077-1083C>T
    2.

    rs1344694 [Homo sapiens]
      TACACCACAATAAAGAAAAAGAACA[A/C/G/T]AAAAAGGAAGAAAAAAATAAGGCTT
      Chromosome:
      2:216028914
      Gene:
      PECR (GeneView)
      Functional Consequence:
      downstream variant 500B
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency
      Global MAF:
      T=0.3013/1509
      HGVS:
      CM000664.2:g.216028914T>A, CM000664.2:g.216028914T>C, CM000664.2:g.216028914T>G, NC_000002.11:g.216893637T>G, NC_000002.12:g.216028914T>A, NC_000002.12:g.216028914T>C, NC_000002.12:g.216028914T>G, XR_001738847.1:n.5015A>C, XR_001738847.1:n.5015A>G, XR_001738847.1:n.5015A>T

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center