Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 23

1.

rs13358880 [Homo sapiens]
    AGAAAGGTAACAAAAAGCTACAAAA[A/G]GACATAATGTGAAAAGTGTGTGTTT
    Chromosome:
    5:57513472
    Gene:
    LOC102724122 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.0667/334
    HGVS:
    NC_000005.10:g.57513472G>A, NC_000005.9:g.56809299G>A, XR_427722.3:n.1256+711G>A
    2.

    rs11208285 [Homo sapiens]
      CTCTCCACAGAATCTTAGCCGTCAT[A/T]CTGGTCCAAATTCCTCTTGGTCCAG
      Chromosome:
      1:63755972
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.3744/1875
      HGVS:
      NC_000001.10:g.64221643T>A, NC_000001.11:g.63755972T>A
      3.

      rs10981870 [Homo sapiens]
        ACATTGTACCCTATGCCTAAGAGAA[A/G]CAGAATTAGCAAACCGCTGGCCCTG
        Chromosome:
        9:113659996
        Gene:
        LOC105376223 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.2592/1298
        HGVS:
        NC_000009.11:g.116422276A>G, NC_000009.12:g.113659996A>G, XR_930254.2:n.180+7916A>G
        5.

        rs9804190 [Homo sapiens]
          GTGCTACCTCAAGAAGGTAAGGAAA[C/T]GTGATTCTTGCAAAGTGGGAAGAAA
          Chromosome:
          10:60080073
          Gene:
          ANK3 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.2578/1291
          HGVS:
          NC_000010.10:g.61839831C>T, NC_000010.11:g.60080073C>T, NG_029917.1:g.658454G>A, NM_001149.3:c.1807+464G>A, NM_001204403.1:c.4387+464G>A, NM_001204404.1:c.4408+464G>A, NM_001320874.1:c.4405+464G>A, NM_020987.4:c.4432+464G>A, XM_005269710.1:c.4432+464G>A, XM_005269711.1:c.4432+464G>A, XM_005269712.1:c.4417+464G>A, XM_005269713.1:c.4366+464G>A, XM_005269714.1:c.4339+464G>A, XM_005269715.1:c.4459+464G>A, XM_005269715.3:c.4459+464G>A, XM_005269716.1:c.4405+464G>A, XM_006717796.3:c.4498+464G>A, XM_006717802.3:c.4498+464G>A, XM_011539708.2:c.4498+464G>A, XM_011539709.2:c.4498+464G>A, XM_017016110.1:c.4498+464G>A, XM_017016111.1:c.4486+464G>A, XM_017016112.1:c.4483+464G>A, XM_017016113.1:c.4471+464G>A, XM_017016114.1:c.4447+464G>A, XM_017016115.1:c.4420+464G>A, XM_017016116.1:c.4498+464G>A, XM_017016117.1:c.4498+464G>A, XM_017016118.1:c.4498+464G>A, XM_017016119.1:c.4498+464G>A, XM_017016120.1:c.4498+464G>A, XM_017016121.1:c.4471+464G>A, XM_017016122.1:c.4405+464G>A, XM_017016123.1:c.4498+464G>A, XM_017016124.1:c.4471+464G>A, XM_017016125.1:c.4471+464G>A, XM_017016126.1:c.4366+464G>A, XM_017016127.1:c.4339+464G>A, XM_017016128.1:c.4471+464G>A, XM_017016129.1:c.4471+464G>A, XM_017016130.1:c.4405+464G>A, XM_017016131.1:c.4390+464G>A, XM_017016132.1:c.4369+500G>A, XM_017016133.1:c.4354+464G>A, XM_017016134.1:c.4339+464G>A, XM_017016135.1:c.4318+500G>A, XM_017016136.1:c.4498+464G>A, XM_017016137.1:c.4471+464G>A, XM_017016138.1:c.4471+464G>A, XM_017016139.1:c.4405+464G>A, XM_017016140.1:c.4405+464G>A, XM_017016141.1:c.4366+464G>A, XM_017016142.1:c.4354+464G>A, XM_017016143.1:c.4339+464G>A, XM_017016144.1:c.4339+464G>A, XM_017016145.1:c.4327+464G>A, XM_017016146.1:c.4327+464G>A, XM_017016147.1:c.4318+500G>A, XM_017016148.1:c.4288+464G>A, XM_017016149.1:c.4276+464G>A, XM_017016150.1:c.4432+464G>A
          7.

          rs6046396 [Homo sapiens]
            AGTTTATTTCAATGATGTTTATGAG[A/G]AGGACGCTAAGATTTAGGAATTGTG
            Chromosome:
            20:19871859
            Gene:
            RIN2 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.3468/1737
            HGVS:
            NC_000020.10:g.19852503G>A, NC_000020.11:g.19871859G>A, XM_005260731.1:c.-36-17707G>A, XM_005260731.2:c.-36-17707G>A, XM_006723574.3:c.-37+564G>A, XM_006723575.3:c.-36-17707G>A, XM_017027887.1:c.-34+564G>A, XM_017027888.1:c.-34+564G>A
            8.

            rs5907577 [Homo sapiens]
              GTTATGATATTGTGTTATAATTTTA[C/T]AAAGTGTCGTCAGTGAGGGAAATGG
              Chromosome:
              X:140084524
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.2535/957
              HGVS:
              NC_000023.10:g.139166683C>T, NC_000023.11:g.140084524C>T
              9.

              rs4924281 [Homo sapiens]
                TTTTAGCTTTCTGTCAATTCTCTAA[C/T]GTACTGATGGGCTTTCCAAAAGTTT
                Chromosome:
                15:38663446
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                C=0.1028/515
                HGVS:
                NC_000015.10:g.38663446C>T, NC_000015.9:g.38955647C>T
                10.

                rs4825220 [Homo sapiens]
                  aaattacagccatcctaatgaacgt[A/G]gagtagtatttcattgtgactttga
                  Chromosome:
                  X:140132319
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  G=0.3637/1373
                  HGVS:
                  NC_000023.10:g.139214478A>G, NC_000023.11:g.140132319A>G
                  11.

                  rs4671826 [Homo sapiens]
                    aaggctctgcatcttctatactgct[C/T]acctcctcatgtcatctgcccttct
                    Chromosome:
                    2:67681817
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    T=0.4143/2075
                    HGVS:
                    NC_000002.11:g.67908949C>T, NC_000002.12:g.67681817C>T
                    12.

                    rs4671825 [Homo sapiens]
                      tcagcagtcaaatcagcagtcagat[C/T]gcctcacttccctgcataaactctt
                      Chromosome:
                      2:67681714
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      C=0.4145/2076
                      HGVS:
                      NC_000002.11:g.67908846T>C, NC_000002.12:g.67681714T>C
                      13.

                      rs4657247 [Homo sapiens]
                        ATCATATTTGTCCTATCCCTATCAC[C/T]GTATCTTGCATGTATGTGTTGATTA
                        Chromosome:
                        1:163182107
                        Gene:
                        LOC101928404 (GeneView) RGS5 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        T=0.2404/1204
                        HGVS:
                        NC_000001.10:g.163151897C>T, NC_000001.11:g.163182107C>T, NG_027731.2:g.144685G>A, NM_001195303.2:c.-108+20685G>A, NM_001254748.1:c.-280-13739G>A, NM_001254749.1:c.45-13739G>A, NM_003617.3:c.45-13739G>A, NR_110699.1:n.258+19231C>T, XR_241139.1:n.261+19231C>T
                        14.

                        rs4389663 [Homo sapiens]
                          CAAATTGTGGGCAGCTTCCATTACT[A/T]TATGTTCATGTTCAAATATATAAGA
                          Chromosome:
                          5:105087983
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency
                          Global MAF:
                          A=0.3710/1858
                          HGVS:
                          NC_000005.10:g.105087983A>T, NC_000005.9:g.104423684A>T
                          15.

                          rs2769605 [Homo sapiens]
                            GTGAGACCAGAAAGAGGAAAGGAGC[A/G]TGGAGCTGCAGCCTGGCCTAGATGG
                            Chromosome:
                            9:85297756
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            T=0.3764/1885
                            HGVS:
                            NC_000009.11:g.87912671C>T, NC_000009.12:g.85297756C>T
                            16.

                            rs2643217 [Homo sapiens]
                              GACTGACCCTCCTGCCATTGATAGT[A/G]AGAAAGTTTCCTCCCCATCCTGAAT
                              Chromosome:
                              15:38711562
                              Validated:
                              by 1000G,by cluster,by frequency,by hapmap,by submitter
                              Global MAF:
                              T=0.0829/415
                              HGVS:
                              NC_000015.10:g.38711562C>T, NC_000015.9:g.39003763C>T
                              17.

                              rs2172835 [Homo sapiens]
                                TAGAAGCTGGCGTTTTTAGGAAGCA[C/T]GTAGAACTCTCTGCTCCTTCATAGT
                                Chromosome:
                                15:38697970
                                Gene:
                                C15orf53 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                Global MAF:
                                T=0.1837/920
                                HGVS:
                                NC_000015.10:g.38697970C>T, NC_000015.9:g.38990171C>T, NM_207444.2:c.133-168C>T
                                18.
                                19.

                                rs2012353 [Homo sapiens]
                                  TTTAATATGCAGAAATAAAAGCAAC[C/T]CAAATTGCTGCTTTAGTTTAAATCA
                                  Chromosome:
                                  19:32408387
                                  Gene:
                                  DPY19L3 (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  A=0.1637/820
                                  HGVS:
                                  NC_000019.10:g.32408387G>A, NC_000019.9:g.32899293G>A, NM_001172774.1:c.103+31G>A, NM_207325.2:c.103+31G>A, XM_005258561.1:c.103+31G>A, XM_011526526.2:c.103+31G>A, XM_017026366.1:c.103+31G>A, XM_017026367.1:c.-643+31G>A, XR_001753612.1:n.318+31G>A, XR_001753613.1:n.318+31G>A, XR_001753614.1:n.301+31G>A, XR_243904.1:n.301+31G>A, XR_935751.1:n.318+31G>A, XR_935753.2:n.318+31G>A
                                  20.

                                  rs1938526 [Homo sapiens]
                                    CTCACCATGGTGTCTCTTAATCTCA[C/T]TGTCATGGCCATCTTCATCCATGTA
                                    Chromosome:
                                    10:60540625
                                    Gene:
                                    ANK3 (GeneView)
                                    Functional Consequence:
                                    intron variant
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                    Global MAF:
                                    G=0.1472/737
                                    HGVS:
                                    NC_000010.10:g.62300383A>G, NC_000010.11:g.60540625A>G, NG_029917.1:g.197902T>C, NM_001204403.1:c.96+74561T>C, NM_001204404.1:c.63+31840T>C, XM_005269713.1:c.63+31840T>C, XM_017016114.1:c.63+31840T>C, XM_017016133.1:c.63+31840T>C, XM_017016135.1:c.63+31840T>C, XM_017016148.1:c.63+31840T>C, XM_017016149.1:c.63+31840T>C

                                    Display Settings:

                                    Format
                                    Items per page
                                    Sort by

                                    Send to:

                                    Choose Destination

                                    Supplemental Content

                                    Find related data

                                    Recent activity

                                    Your browsing activity is empty.

                                    Activity recording is turned off.

                                    Turn recording back on

                                    See more...
                                    Support Center