Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 5

1.

rs2279744 [Homo sapiens]
    GGGGGCCGGGGGCTGCGGGGCCGCT[G/T]CGGCGCGGGAGGTCCGGATGATCGC
    Chromosome:
    12:68808800
    Gene:
    MDM2 (GeneView)
    Functional Consequence:
    intron variant,upstream variant 2KB
    Allele Origin:
    G(germline)/T(germline)
    Clinical significance:
    other
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    G=0.3666/1836
    HGVS:
    NC_000012.11:g.69202580T>G, NC_000012.12:g.68808800T>G, NG_016708.1:g.5610T>G, NM_001145337.2:c.-291T>G, NM_001145339.2:c.14+309T>G, NM_001145340.2:c.-291T>G, NM_001278462.1:c.-291T>G, NM_002392.5:c.14+309T>G, XM_005268872.1:c.-291T>G, XM_005268872.4:c.-291T>G, XM_006719400.3:c.-174+309T>G
    3.

    rs1529916 [Homo sapiens]
      TCTGTAAATGACAGGCTTCTTGCAT[C/T]AAGGCCACTTTTGTTAACCTCCCGT
      Chromosome:
      16:8897333
      Gene:
      USP7 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap,by submitter
      Global MAF:
      A=0.2724/1364
      HGVS:
      NC_000016.10:g.8897333G>A, NC_000016.9:g.8991190G>A, NG_046847.1:g.71152C>T, NM_001286457.1:c.2671-234C>T, NM_001286458.1:c.2422-234C>T, NM_001321858.1:c.2545-234C>T, NM_003470.2:c.2719-234C>T, NR_135826.1:n.2700-234C>T, XM_005255565.1:c.2671-234C>T, XM_017023652.1:c.2719-234C>T, XM_017023653.1:c.2671-234C>T
      4.

      rs1042522 [Homo sapiens]
        CCCAGAATGCCAGAGGCTGCTCCCC[C/G]CGTGGCCCCTGCACCAGCAGCTCCT
        Chromosome:
        17:7676154
        Gene:
        TP53 (GeneView)
        Functional Consequence:
        missense,upstream variant 2KB
        Allele Origin:
        G(germline)/A(germline)/C(germline)
        Clinical significance:
        drug-response
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.4571/2289
        HGVS:
        NC_000017.10:g.7579472G, NC_000017.10:g.7579472G>C, NC_000017.10:g.7579472G>T, NC_000017.11:g.7676154G, NC_000017.11:g.7676154G>C, NC_000017.11:g.7676154G>T, NG_017013.2:g.16397C, NG_017013.2:g.16397C>A, NG_017013.2:g.16397C>G, NM_000546.5:c.215C, NM_000546.5:c.215C>A, NM_000546.5:c.215C>G, NM_001126112.2:c.215C, NM_001126112.2:c.215C>A, NM_001126112.2:c.215C>G, NM_001126113.2:c.215C, NM_001126113.2:c.215C>A, NM_001126113.2:c.215C>G, NM_001126114.2:c.215C, NM_001126114.2:c.215C>A, NM_001126114.2:c.215C>G, NM_001126115.1:c.-939C, NM_001126115.1:c.-939C>A, NM_001126115.1:c.-939C>G, NM_001126116.1:c.-939C, NM_001126116.1:c.-939C>A, NM_001126116.1:c.-939C>G, NM_001126117.1:c.-939C, NM_001126117.1:c.-939C>A, NM_001126117.1:c.-939C>G, NM_001126118.1:c.98C, NM_001126118.1:c.98C>A, NM_001126118.1:c.98C>G, NM_001276695.1:c.98C, NM_001276695.1:c.98C>A, NM_001276695.1:c.98C>G, NM_001276696.1:c.98C, NM_001276696.1:c.98C>A, NM_001276696.1:c.98C>G, NM_001276697.1:c.-1020C, NM_001276697.1:c.-1020C>A, NM_001276697.1:c.-1020C>G, NM_001276698.1:c.-1020C, NM_001276698.1:c.-1020C>A, NM_001276698.1:c.-1020C>G, NM_001276699.1:c.-1020C, NM_001276699.1:c.-1020C>A, NM_001276699.1:c.-1020C>G, NM_001276760.1:c.98C, NM_001276760.1:c.98C>A, NM_001276760.1:c.98C>G, NM_001276761.1:c.98C, NM_001276761.1:c.98C>A, NM_001276761.1:c.98C>G, NP_000537.3:p.Pro72, NP_000537.3:p.Pro72Arg, NP_000537.3:p.Pro72His, NP_001119584.1:p.Pro72, NP_001119584.1:p.Pro72Arg, NP_001119584.1:p.Pro72His, NP_001119585.1:p.Pro72, NP_001119585.1:p.Pro72Arg, NP_001119585.1:p.Pro72His, NP_001119586.1:p.Pro72, NP_001119586.1:p.Pro72Arg, NP_001119586.1:p.Pro72His, NP_001119590.1:p.Pro33, NP_001119590.1:p.Pro33Arg, NP_001119590.1:p.Pro33His, NP_001263624.1:p.Pro33, NP_001263624.1:p.Pro33Arg, NP_001263624.1:p.Pro33His, NP_001263625.1:p.Pro33, NP_001263625.1:p.Pro33Arg, NP_001263625.1:p.Pro33His, NP_001263689.1:p.Pro33, NP_001263689.1:p.Pro33Arg, NP_001263689.1:p.Pro33His, NP_001263690.1:p.Pro33, NP_001263690.1:p.Pro33Arg, NP_001263690.1:p.Pro33His, XM_005256778.1:c.176-21C, XM_005256778.1:c.176-21C>A, XM_005256778.1:c.176-21C>G, XR_243565.1:n.354C, XR_243565.1:n.354C>A, XR_243565.1:n.354C>G, XR_243566.1:n.354C, XR_243566.1:n.354C>A, XR_243566.1:n.354C>G
        5.

        rs929271 [Homo sapiens]
          AACAGTGTGAACCAGCCCCCTGGAA[G/T]CAAGACAGAAAGGCACCCGGCCTCT
          Chromosome:
          22:30242237
          Gene:
          LIF (GeneView)
          Functional Consequence:
          utr variant 3 prime
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.2941/1473
          HGVS:
          NC_000022.10:g.30638226T>G, NC_000022.11:g.30242237T>G, NG_008721.1:g.9571A>C, NM_001257135.1:c.*1577A>C, NM_002309.4:c.*1414A>C, XM_005261601.1:c.*1414A>C

          Display Settings:

          Format
          Sort by

          Send to:

          Choose Destination

          Supplemental Content

          Find related data

          Recent activity

          Your browsing activity is empty.

          Activity recording is turned off.

          Turn recording back on

          See more...
          Support Center