Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 3

1.

rs314277 [Homo sapiens]
    CATTTTCTCTCAGGCTCTTTCTTCC[A/C/T]CCTTTGAACCTTCTTTAGGTTGTTA
    Chromosome:
    6:104959787
    Gene:
    LIN28B (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.2063/1033
    HGVS:
    NC_000006.11:g.105407662A>C, NC_000006.12:g.104959787A>C, NC_000006.12:g.104959787A>T, NG_032815.1:g.7740A>C, NG_032815.1:g.7740A>T, NM_001004317.3:c.198+1501A>C, NM_001004317.3:c.198+1501A>T, XM_005266975.1:c.255+1501A>C, XM_006715477.2:c.255+1501A>C, XM_006715477.2:c.255+1501A>T, XM_011535818.2:c.222+1501A>C, XM_011535818.2:c.222+1501A>T
    2.

    rs314276 [Homo sapiens]
      TTGATTTTTAAATAGTTGACTTAAT[A/C]TTCAGTTACATACAGTAGTATATAC
      Chromosome:
      6:104960124
      Gene:
      LIN28B (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.3526/1766
      HGVS:
      NC_000006.11:g.105407999A>C, NC_000006.12:g.104960124A>C, NG_032815.1:g.8077A>C, NM_001004317.3:c.198+1838A>C, XM_005266975.1:c.255+1838A>C, XM_006715477.2:c.255+1838A>C, XM_011535818.2:c.222+1838A>C
      3.

      rs312726 [Homo sapiens]
        TTACAAGCCAATTCCCTTTGCATTC[G/T]TTAGTCTGCCTAGAATTACCCTCAT
        Chromosome:
        17:70292187
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
        Global MAF:
        C=0.2674/1339
        HGVS:
        NC_000017.10:g.68288328C>A, NC_000017.11:g.70292187C>A

        Display Settings:

        Format
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Support Center