Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 46

2.

rs17486278 [Homo sapiens]
    AGCAAGGTTACATTTCTTTGAAAAT[A/C]AATGTGGTTTCACCAAATGATTTGA
    Chromosome:
    15:78575140
    Gene:
    CHRNA5 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.2788/1396
    HGVS:
    NC_000015.10:g.78575140A>C, NC_000015.9:g.78867482A>C, NG_023328.1:g.14621A>C, NM_000745.3:c.107-5671A>C, NM_001307945.1:c.107-5671A>C, XM_005254142.1:c.107-5671A>C, XM_005254142.3:c.107-5671A>C, XM_017021881.1:c.107-5671A>C, XR_001751067.1:n.306-5671A>C
    3.

    rs16970006 [Homo sapiens]
      AGACCTTTCCTCAATACAGGTCTTA[C/T]GTATTTCAGTCAAAGATATTTCTCT
      Chromosome:
      15:78677917
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.1655/829
      HGVS:
      NC_000015.10:g.78677917T>C, NC_000015.9:g.78970259T>C
      4.

      rs16969968 [Homo sapiens]
        TAGAAACACATTGGAAGCTGCGCTC[A/G]ATTCTATTCGCTACATTACAAGACA
        Chromosome:
        15:78590583
        Gene:
        CHRNA5 (GeneView)
        Functional Consequence:
        intron variant,missense,nc transcript variant
        Allele Origin:
        G(germline)/A(germline)
        Clinical significance:
        other
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.1496/749
        HGVS:
        NC_000015.10:g.78590583G>A, NC_000015.9:g.78882925G>A, NG_023328.1:g.30064G>A, NM_000745.3:c.1192G>A, NM_001307945.1:c.458+734G>A, NP_000736.2:p.Asp398Asn, XM_005254142.1:c.707+485G>A, XM_005254142.3:c.707+485G>A, XM_017021881.1:c.713+479G>A, XR_001751067.1:n.1391G>A
        6.

        rs12910984 [Homo sapiens]
          AGCCACTGTGCCTGGCTTATATCTA[A/G]CTCCTAAAGTCTTTAAAGCACAATG
          Chromosome:
          15:78599285
          Gene:
          CHRNA3 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.4113/2060
          HGVS:
          NC_000015.10:g.78599285G>A, NC_000015.9:g.78891627G>A, NG_016143.1:g.27011C>T, NM_000743.4:c.1389+1968C>T, NM_001166694.1:c.1389+1968C>T, NR_046313.1:n.1890+1968C>T, XM_006720382.2:c.1188+1968C>T
          8.

          rs11637635 [Homo sapiens]
            TTGCCTAACAGGCATATTCAGATAC[A/G]GGGATCAGCAGTTATTCTGGGTGGT
            Chromosome:
            15:78584808
            Gene:
            CHRNA5 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.2546/1275
            HGVS:
            NC_000015.10:g.78584808A>G, NC_000015.9:g.78877150A>G, NG_023328.1:g.24289A>G, NM_000745.3:c.259-1837A>G, NM_001307945.1:c.259-1837A>G, XM_005254142.1:c.259-1837A>G, XM_005254142.3:c.259-1837A>G, XM_017021881.1:c.259-1837A>G, XR_001751067.1:n.458-1837A>G
            9.

            rs11637630 [Homo sapiens]
              TGTCCATGAATACTCTGAGGATTCT[A/G]TCAGCAAATGAACTTTAGAAAACAA
              Chromosome:
              15:78607377
              Gene:
              CHRNA3 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.4010/2008
              HGVS:
              NC_000015.10:g.78607377G>A, NC_000015.9:g.78899719G>A, NG_016143.1:g.18919C>T, NM_000743.4:c.378-5113C>T, NM_001166694.1:c.378-5113C>T, NR_046313.1:n.879-5113C>T, XM_006720382.2:c.177-5113C>T
              10.

              rs11636605 [Homo sapiens]
                CTCTACCTCTACCCCAGATACTCAG[A/G]TACTCTCTCTTCTGGCCATAGCCTA
                Chromosome:
                15:78636536
                Gene:
                CHRNB4 (GeneView)
                Functional Consequence:
                intron variant,upstream variant 2KB
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                G=0.4451/2229
                HGVS:
                NC_000015.10:g.78636536A>G, NC_000015.9:g.78928878A>G, NM_000750.3:c.56-949T>C, NM_001256567.1:c.56-949T>C, XM_011521186.2:c.47-949T>C, XM_011521187.2:c.47-949T>C, XM_011521190.2:c.-1933T>C, XM_011521191.2:c.-19+4543T>C, XM_011521192.2:c.-639-949T>C, XM_017021885.1:c.-36+401T>C, XM_017021886.1:c.-36+729T>C, XM_017021887.1:c.56-949T>C, XM_017021888.1:c.56-949T>C, XM_017021889.1:c.56-949T>C
                11.

                rs8192479 [Homo sapiens]
                  ACAGCACAATGTCTGGCTTCCAGAT[C/T]TTCTGTGCAGGGACACGCATGAACT
                  Chromosome:
                  15:78617056
                  Gene:
                  CHRNA3 (GeneView)
                  Functional Consequence:
                  nc transcript variant,synonymous codon
                  Validated:
                  by 1000G,by cluster,by frequency
                  Global MAF:
                  T=0.0062/31
                  HGVS:
                  NC_000015.10:g.78617056C>T, NC_000015.9:g.78909398C>T, NG_016143.1:g.9240G>A, NM_000743.4:c.345G>A, NM_001166694.1:c.345G>A, NP_000734.2:p.Lys115, NP_001160166.1:p.Lys115, NR_046313.1:n.846G>A, XM_006720382.2:c.144G>A, XP_006720445.1:p.Lys48
                  12.
                  13.

                  rs8040868 [Homo sapiens]
                    TGATGACTGGGTCAGACACGTTGGC[C/T]ACAGGCCGGATGATCTCATTGTAAT
                    Chromosome:
                    15:78618839
                    Gene:
                    CHRNA3 (GeneView)
                    Functional Consequence:
                    nc transcript variant,synonymous codon,utr variant 5 prime
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    C=0.3285/1645
                    HGVS:
                    NC_000015.10:g.78618839T>C, NC_000015.9:g.78911181T>C, NG_016143.1:g.7457A>G, NM_000743.4:c.159A>G, NM_001166694.1:c.159A>G, NP_000734.2:p.Val53, NP_001160166.1:p.Val53, NR_046313.1:n.660A>G, XM_006720382.2:c.-43A>G
                    14.

                    rs7164030 [Homo sapiens]
                      TAAGTAGAAAACCAAAGACAGCTAA[A/G]TTTTAAATCTTGAGTCAAAACTTTA
                      Chromosome:
                      15:78552319
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      G=0.2472/1238
                      HGVS:
                      NC_000015.10:g.78552319G>A, NC_000015.9:g.78844661G>A
                      15.

                      rs6495308 [Homo sapiens]
                        TAACTGTCTGATGGCAGGTTTGCTG[C/T]TGGGAGAGTAGAGAAGAGGTTTGGG
                        Chromosome:
                        15:78615314
                        Gene:
                        CHRNA3 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        C=0.4495/2251
                        HGVS:
                        NC_000015.10:g.78615314T>C, NC_000015.9:g.78907656T>C, NG_016143.1:g.10982A>G, NM_000743.4:c.377+1710A>G, NM_001166694.1:c.377+1710A>G, NR_046313.1:n.878+1710A>G, XM_006720382.2:c.176+1710A>G
                        16.

                        rs6495306 [Homo sapiens]
                          ATTAACGAATTGAACAAGATATCAC[A/G]TTAGGCTCTAGTGTGGCCAAGTTGT
                          Chromosome:
                          15:78573551
                          Gene:
                          CHRNA5 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          G=0.2774/1389
                          HGVS:
                          NC_000015.10:g.78573551G>A, NC_000015.9:g.78865893G>A, NG_023328.1:g.13032G>A, NM_000745.3:c.107-7260G>A, NM_001307945.1:c.107-7260G>A, XM_005254142.1:c.107-7260G>A, XM_005254142.3:c.107-7260G>A, XM_017021881.1:c.107-7260G>A, XR_001751067.1:n.306-7260G>A
                          17.

                          rs4887075 [Homo sapiens]
                            CTGGCCTGGGCCCAGGCCCTACTCC[C/T]GAGGTCAGGCTTGTCCCAAGAGAGG
                            Chromosome:
                            15:78660789
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            C=0.1358/680
                            HGVS:
                            NC_000015.10:g.78660789C>T, NC_000015.9:g.78953131C>T
                            18.

                            Error occurred: cannot get document summary

                            19.

                            rs3813567 [Homo sapiens]
                              CACTTCAACAGTGTTGTTGTTGTTG[C/T]TTTTAAAGACCATATGTCAACATGT
                              Chromosome:
                              15:78642209
                              Gene:
                              CHRNB4 (GeneView)
                              Functional Consequence:
                              intron variant,upstream variant 2KB
                              Validated:
                              by 1000G,by cluster,by frequency,by hapmap
                              Global MAF:
                              G=0.3385/1695
                              HGVS:
                              NC_000015.10:g.78642209G>A, NC_000015.9:g.78934551G>A, NM_000750.3:c.-1076C>T, NM_001256567.1:c.-1076C>T, XM_011521186.2:c.47-6622C>T, XM_011521187.2:c.47-6622C>T, XM_011521191.2:c.-1149C>T, XM_011521192.2:c.-1770C>T, XM_017021887.1:c.-1076C>T, XM_017021888.1:c.-1076C>T, XM_017021889.1:c.-1076C>T
                              20.

                              rs3743078 [Homo sapiens]
                                CCTCAGTATCCCTGTTGGTAAATGG[C/G]GCCAGGAAATGGGTGACCTTTTATG
                                Chromosome:
                                15:78602417
                                Gene:
                                CHRNA3 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                Global MAF:
                                G=0.4449/2228
                                HGVS:
                                NC_000015.10:g.78602417C>G, NC_000015.9:g.78894759C>G, NG_016143.1:g.23879G>C, NM_000743.4:c.378-153G>C, NM_001166694.1:c.378-153G>C, NR_046313.1:n.879-153G>C, XM_006720382.2:c.177-153G>C

                                Display Settings:

                                Format
                                Items per page
                                Sort by

                                Send to:

                                Choose Destination

                                Supplemental Content

                                Find related data

                                Recent activity

                                Your browsing activity is empty.

                                Activity recording is turned off.

                                Turn recording back on

                                See more...
                                Support Center