Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 42

1.

rs16962449 [Homo sapiens]
    TCATTCATATATTAGCTTGCTCACT[C/G]TTTCAGGACCTGAAGGTAGAATCAA
    Chromosome:
    13:103456264
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.3950/1978
    HGVS:
    NC_000013.10:g.104108614G>C, NC_000013.11:g.103456264G>C
    2.

    rs16928809 [Homo sapiens]
      TTGCTCAGCTGCTGAGAGGAAGGCC[A/G]TGGCGGTCCGGCACAGGCCTGGAGG
      Chromosome:
      11:2915722
      Gene:
      SLC22A18 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.0729/365
      HGVS:
      NC_000011.10:g.2915722G>A, NC_000011.9:g.2936952G>A, NG_011512.1:g.21002G>A, NM_001315501.1:c.792-900G>A, NM_001315502.1:c.243-900G>A, NM_002555.5:c.537-900G>A, NM_183233.2:c.537-900G>A, NT_187585.1:g.147940G>A, XM_005252952.1:c.792-900G>A, XM_005252953.1:c.107+466G>A, XM_011520141.2:c.792-900G>A, XM_011520142.2:c.792-900G>A
      3.

      rs12923103 [Homo sapiens]
        TTGCCCTGTATCCCTTGTCCTGTTC[A/G]TGGAACTTCTCAGCCTTACTCAGCT
        Chromosome:
        16:73345035
        Gene:
        C16orf47 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.3241/1623
        HGVS:
        NC_000016.10:g.73345035A>G, NC_000016.9:g.73378934A>G, XM_017023228.1:c.-237-26699T>C
        4.

        rs12714207 [Homo sapiens]
          ACTGCTAGCATACCTGTTTTTTCTT[C/T]TTTAGCCATATTGCTGTGAAATTGG
          Chromosome:
          2:88016274
          Gene:
          LOC105374852 (GeneView)
          Functional Consequence:
          upstream variant 2KB
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.3259/1632
          HGVS:
          NC_000002.11:g.88315793C>T, NC_000002.12:g.88016274C>T, NG_045085.1:g.374G>A, XR_940335.2:n.-125C>T, XR_940336.2:n.-131C>T, XR_940337.1:n.-604C>T
          6.

          rs12337836 [Homo sapiens]
            TTCCTAGCCCCTCTTCCTTCCCTCC[A/C]CAATATGCAAAATACACACATGCCT
            Chromosome:
            9:101314314
            Gene:
            PLPPR1 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.0569/285
            HGVS:
            NC_000009.11:g.104076596C>A, NC_000009.12:g.101314314C>A, NM_017753.2:c.813+1340C>A, NM_207299.1:c.813+1340C>A, NT_187578.1:g.365517C>A
            7.

            rs12206204 [Homo sapiens]
              AGGAGTAGTAAGAAAGTGGCTCATT[C/T]TCCAGATTTACTCTCTTTTTCTTAA
              Chromosome:
              6:26116754
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.0102/51
              HGVS:
              NC_000006.11:g.26116982C>T, NC_000006.12:g.26116754C>T, XM_005249440.1:c.*10-1619G>A
              8.
              9.

              rs11645060 [Homo sapiens]
                AATGTCCCCTGAGGAGAGAGGTGAA[A/G]TGTGAATCTGTGAAGAATCCAGGGT
                Chromosome:
                16:4441060
                Gene:
                DNAJA3 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.0238/119
                HGVS:
                NC_000016.10:g.4441060G>A, NC_000016.9:g.4491061G>A, NG_029866.1:g.20256G>A, NM_001135110.2:c.430-315G>A, NM_001286516.1:c.102-446G>A, NM_005147.5:c.430-315G>A, NT_187608.1:g.143383G>A, XM_005255677.1:c.102-446G>A
                10.

                rs11190297 [Homo sapiens]
                  TTCATTAAATCCCACTGTAGTTTGA[G/T]TATGTAGAGGGTCATGCTGCCTTTT
                  Chromosome:
                  10:99858346
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  T=0.0166/83
                  HGVS:
                  NC_000010.10:g.101618103G>T, NC_000010.11:g.99858346G>T
                  12.

                  rs10486752 [Homo sapiens]
                    ACTCCAGAGCTTTGTCAGCAATAAA[C/T]TAGTGATTTTCATTAACCCAGTATT
                    Chromosome:
                    7:43762384
                    Gene:
                    BLVRA (GeneView)
                    Functional Consequence:
                    intron variant,upstream variant 2KB
                    Validated:
                    by 1000G,by cluster,by frequency,by hapmap
                    Global MAF:
                    G=0.1623/813
                    HGVS:
                    NC_000007.13:g.43801983A>G, NC_000007.14:g.43762384A>G, NG_031876.1:g.8712A>G, NM_000712.3:c.-22+3650A>G, NM_001253823.1:c.-22+2274A>G, XM_011515474.2:c.-22+4168A>G, XM_017012520.1:c.-1943A>G
                    14.

                    rs10476123 [Homo sapiens]
                      AGAGTAAGATGGGGTGGGGTGGGCC[C/T]GGGGGCGGGGGTCTATTGCCAAAGG
                      Chromosome:
                      5:174791389
                      Validated:
                      by 1000G,by cluster,by frequency,by hapmap
                      Global MAF:
                      T=0.3710/1858
                      HGVS:
                      NC_000005.10:g.174791389C>T, NC_000005.9:g.174218392C>T
                      15.

                      rs9380833 [Homo sapiens]
                        GCACACGCCATGTCTGCTCATATCT[C/T]GTTGGGACATAAGTCAGTCATGTGA
                        Chromosome:
                        6:39171688
                        Validated:
                        by 1000G,by cluster,by frequency,by hapmap
                        Global MAF:
                        T=0.1006/504
                        HGVS:
                        NC_000006.11:g.39139464C>T, NC_000006.12:g.39171688C>T
                        17.

                        rs8007929 [Homo sapiens]
                          GTGAGAGGCAGAGCACCTCACTGTA[A/G]TCTGGATCTGCCCACAATGCCCTGT
                          Chromosome:
                          14:69733746
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          A=0.1250/626
                          HGVS:
                          NC_000014.8:g.70200463G>A, NC_000014.9:g.69733746G>A
                          18.

                          rs7605199 [Homo sapiens]
                            tgacatggtttgaatggcatgagtg[A/G]tggtagagtgatccaattcttccac
                            Chromosome:
                            2:168999944
                            Gene:
                            ABCB11 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            G=0.3906/1956
                            HGVS:
                            NC_000002.11:g.169856454A>G, NC_000002.12:g.168999944A>G, NG_007374.1:g.36380T>C, NM_003742.2:c.390-3222T>C, XM_006712817.3:c.432-3222T>C, XM_011512077.2:c.492-3222T>C, XM_011512078.2:c.492-3222T>C, XM_011512080.2:c.492-3222T>C, XM_017005165.1:c.492-3222T>C
                            19.

                            rs7173819 [Homo sapiens]
                              GGTACGTTGGAGTATAATAAAATAT[A/G]AAAAAACCCTACTTATCTTCAATGA
                              Chromosome:
                              15:96909448
                              Validated:
                              by 1000G,by cluster,by frequency,by hapmap
                              Global MAF:
                              G=0.2274/1139
                              HGVS:
                              NC_000015.10:g.96909448A>G, NC_000015.9:g.97452678A>G
                              20.

                              rs7120248 [Homo sapiens]
                                ccttggctgaggccccttcttccat[A/G]ttcaaagtacatcagattggtgagg
                                Chromosome:
                                11:75703241
                                Gene:
                                LOC105369392 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                Global MAF:
                                A=0.1849/926
                                HGVS:
                                NC_000011.10:g.75703241G>A, NC_000011.9:g.75414286G>A, XR_950316.2:n.173-302C>T

                                Display Settings:

                                Format
                                Items per page
                                Sort by

                                Send to:

                                Choose Destination

                                Supplemental Content

                                Find related data

                                Recent activity

                                Your browsing activity is empty.

                                Activity recording is turned off.

                                Turn recording back on

                                See more...
                                Support Center