Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 3

1.

rs6591255 [Homo sapiens]
    TTCTttgttttttaacttttatttc[A/T]gttttgggggtacatgtgaaggttt
    Chromosome:
    11:67582077
    Gene:
    GSTP1 (GeneView)
    Functional Consequence:
    upstream variant 2KB
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency
    Global MAF:
    A=0.3097/1551
    HGVS:
    NC_000011.10:g.67582077T>A, NC_000011.9:g.67349548T>A, NG_012075.1:g.3483T>A, NM_000852.3:c.-1767T>A, XM_005273958.1:c.-1767T>A
    2.

    rs749174 [Homo sapiens]
      CCATTGCCCTTAGGAGACTCCAAAC[C/T]AGTGGGTTCAAGGCCTTCGGGACCT
      Chromosome:
      11:67585782
      Gene:
      GSTP1 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
      Global MAF:
      A=0.2438/1221
      HGVS:
      NC_000011.10:g.67585782G>A, NC_000011.9:g.67353253G>A, NG_012075.1:g.7188G>A, NM_000852.3:c.337-322G>A, XM_005273958.1:c.337-325G>A
      3.

      rs1695 [Homo sapiens]
        CGTGGAGGACCTCCGCTGCAAATAC[A/G]TCTCCCTCATCTACACCAACTATGT
        Chromosome:
        11:67585218
        Gene:
        GSTP1 (GeneView)
        Functional Consequence:
        missense
        Clinical significance:
        drug-response
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.3526/1766
        HGVS:
        NC_000011.10:g.67585218A>G, NC_000011.9:g.67352689A>G, NG_012075.1:g.6624A>G, NM_000852.3:c.313A>G, NP_000843.1:p.Ile105Val, XM_005273958.1:c.313A>G, XP_005274015.1:p.Ile105Val

        Display Settings:

        Format
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Support Center