Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 17

1.

rs17178655 [Homo sapiens]
    TTGTATGTACTGCAGCTCAATTAGA[A/G]GTGGTCTCTGACTTTCATCAGCTTC
    Chromosome:
    10:46034023
    Gene:
    LOC105378287 (GeneView) MSMB (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    A=0.2222/1113
    HGVS:
    CM000672.2:g.46034023C>T, NC_000010.10:g.51561799G>A, NC_000010.11:g.46034023C>T, NG_011551.1:g.17247G>A, NG_023372.1:g.1692G>A, NM_001290117.1:c.515-170973G>A, NM_001290118.1:c.371-170973G>A, NM_002443.3:c.216-472G>A, NM_138634.2:c.110-472G>A, NW_003871068.1:g.305138C>T, XR_945923.2:n.321+1239C>T
    2.

    rs12770171 [Homo sapiens]
      AGGCTCAGCAAAGAGAAGTTCTCTC[C/T]TCCTCTGCTCTTTTAGGTCAGCAGC
      Chromosome:
      10:46046508
      Gene:
      MSMB (GeneView)
      Functional Consequence:
      upstream variant 2KB
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      T=0.1560/781
      HGVS:
      CM000672.2:g.46046508G>A, NC_000010.10:g.51549314C>T, NC_000010.11:g.46046508G>A, NG_011551.1:g.4762C>T, NM_001290117.1:c.514+161551C>T, NM_001290118.1:c.370+161551C>T, NM_002443.3:c.-271C>T, NM_138634.2:c.-271C>T, NW_003871068.1:g.317623G>A
      3.

      rs11593319 [Homo sapiens]
        CTCACAGAAGTCTACGAAGACTGAA[G/T]ACTGTGCAGCAGAGCCCAATATTAC
        Chromosome:
        10:46069929
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.0339/170
        HGVS:
        CM000672.2:g.46069929C>A, NC_000010.10:g.51525893G>T, NM_001290117.1:c.514+138130G>T, NM_001290118.1:c.370+138130G>T, NW_003871068.1:g.341044C>A
        4.

        rs11006207 [Homo sapiens]
          CTCTCTTTCTCCCTCTACCCCCTTT[C/T]TAAGTTGCCCTGGCTATGACCAGTA
          Chromosome:
          10:46057646
          Validated:
          by 1000G,by cluster,by frequency
          Global MAF:
          C=0.4179/2093
          HGVS:
          CM000672.2:g.46057646A>G, NC_000010.10:g.51538176T>C, NM_001290117.1:c.514+150413T>C, NM_001290118.1:c.370+150413T>C, NW_003871068.1:g.328761A>G
          5.

          rs11006027 [Homo sapiens]
            TTATAGTCCCACAAGGAAGTGGATT[C/T]GTGTTAGTTCATCTCTGCTCTTAGG
            Chromosome:
            10:58045035
            Validated:
            by 1000G,by cluster,by frequency
            Global MAF:
            T=0.1805/904
            HGVS:
            CM000672.2:g.58045035C>T, NC_000010.10:g.59804795C>T
            6.

            rs11004422 [Homo sapiens]
              CATGGCCTCTTCTGGGTATGGATGG[A/G]CCTGGCCTCCTCCCCTCCTGAGCTG
              Chromosome:
              10:46097486
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency
              Global MAF:
              G=0.4926/2467
              HGVS:
              CM000672.2:g.46097486T>C, NC_000010.10:g.51498336A>G, NM_001290117.1:c.514+110573A>G, NM_001290118.1:c.370+110573A>G, NW_003871068.1:g.368601T>C
              7.

              rs10994675 [Homo sapiens]
                TGACTGTTATCTTAGCTTCTGCATC[A/G]TAATCTATGTCTCCTATTGTTTTCT
                Chromosome:
                10:46031829
                Gene:
                LOC105378287 (GeneView) NCOA4 (GeneView)
                Functional Consequence:
                intron variant,upstream variant 2KB
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency
                Global MAF:
                A=0.4754/2381
                HGVS:
                CM000672.2:g.46031829C>T, NC_000010.10:g.51563993G>A, NC_000010.11:g.46031829C>T, NG_011551.1:g.19441G>A, NG_023372.1:g.3886G>A, NM_001145260.1:c.-1367G>A, NM_001145261.1:c.-1367G>A, NM_001145263.1:c.-1318G>A, NM_001290117.1:c.515-168779G>A, NM_001290118.1:c.371-168779G>A, NW_003871068.1:g.302944C>T, XR_945923.2:n.126-760C>T
                10.

                rs10826223 [Homo sapiens]
                  TGTGAAAGACATAATATTTCTTCTC[A/G]TCTTATTGTGTCGTGTCGTGTCCTG
                  Chromosome:
                  10:46056997
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency
                  Global MAF:
                  A=0.1070/536
                  HGVS:
                  CM000672.2:g.46056997C>T, NC_000010.10:g.51538825G>A, NM_001290117.1:c.514+151062G>A, NM_001290118.1:c.370+151062G>A, NW_003871068.1:g.328112C>T
                  11.

                  rs10826075 [Homo sapiens]
                    AGAAAGAGAGTATTTGGTTTTCCAG[C/G]CTCTTCAGGAGGAGGTTACTGGGGA
                    Chromosome:
                    10:46068452
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    G=0.2314/1159
                    HGVS:
                    CM000672.2:g.46068452G>C, NC_000010.10:g.51527370C>G, NM_001290117.1:c.514+139607C>G, NM_001290118.1:c.370+139607C>G, NW_003871068.1:g.339567G>C
                    12.

                    rs7904463 [Homo sapiens]
                      ACCTTCTTCCCTGGAATTGCCTCAC[C/T]TCCTTTGTTTTTCTCATGAACTTTT
                      Chromosome:
                      10:46036353
                      Gene:
                      MSMB (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency
                      Global MAF:
                      T=0.4367/2187
                      HGVS:
                      CM000672.2:g.46036353G>A, NC_000010.10:g.51559469C>T, NC_000010.11:g.46036353G>A, NG_011551.1:g.14917C>T, NM_001290117.1:c.514+171706C>T, NM_001290118.1:c.370+171706C>T, NM_002443.3:c.215+2613C>T, NM_138634.2:c.110-2802C>T, NW_003871068.1:g.307468G>A
                      13.

                      rs7081532 [Homo sapiens]
                        AGATGGAGTCTCGCTCTGTCGCTCA[A/G]ACTGGACTACAGTGGCCCAATCTCA
                        Chromosome:
                        10:46069729
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency
                        Global MAF:
                        A=0.4473/2240
                        HGVS:
                        CM000672.2:g.46069729T>C, NC_000010.10:g.51526093A>G, NM_001290117.1:c.514+138330A>G, NM_001290118.1:c.370+138330A>G, NW_003871068.1:g.340844T>C
                        14.

                        rs7076948 [Homo sapiens]
                          TCTGGGCCTTGTAGATTTGTAGAAA[C/T]AGCAGTGGCTCTGAGCATAGGCAGA
                          Chromosome:
                          10:46037697
                          Gene:
                          MSMB (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          C=0.4808/2408
                          HGVS:
                          CM000672.2:g.46037697A>G, NC_000010.10:g.51558125T>C, NC_000010.11:g.46037697A>G, NG_011551.1:g.13573T>C, NM_001290117.1:c.514+170362T>C, NM_001290118.1:c.370+170362T>C, NM_002443.3:c.215+1269T>C, NM_138634.2:c.109+2289T>C, NW_003871068.1:g.308812A>G
                          15.

                          rs7071471 [Homo sapiens]
                            TCACCTCAGTCCCACAAGATCAATC[C/T]CAGCATCTGTCCCTACTGTCTGGAA
                            Chromosome:
                            10:46092487
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            C=0.4900/2454
                            HGVS:
                            CM000672.2:g.46092487G>A, NC_000010.10:g.51503335C>T, NM_001290117.1:c.514+115572C>T, NM_001290118.1:c.370+115572C>T, NW_003871068.1:g.363602G>A
                            16.

                            rs4630240 [Homo sapiens]
                              CCTTTAAATCCTTCGCTTTGGTTTC[A/G]GCTTTAGGAGGGGCAGGAGCTTCCT
                              Chromosome:
                              10:46063294
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency
                              Global MAF:
                              A=0.2742/1373
                              HGVS:
                              CM000672.2:g.46063294C>T, NC_000010.10:g.51532528G>A, NC_000010.11:g.46063294C>T, NG_010857.1:g.145C>T, NG_010857.2:g.158C>T, NM_001290117.1:c.514+144765G>A, NM_001290118.1:c.370+144765G>A, NW_003871068.1:g.334409C>T
                              17.

                              rs2072701 [Homo sapiens]
                                GGAAAAAATGTGGTCCCAAGTACCC[A/G]CAGGCTCACATGGCTATCTAATTCA
                                Chromosome:
                                10:46039373
                                Gene:
                                MSMB (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by cluster,by frequency,by hapmap
                                Global MAF:
                                G=0.1346/674
                                HGVS:
                                CM000672.2:g.46039373T>C, NC_000010.10:g.51556449A>G, NC_000010.11:g.46039373T>C, NG_011551.1:g.11897A>G, NM_001290117.1:c.514+168686A>G, NM_001290118.1:c.370+168686A>G, NM_002443.3:c.110-302A>G, NM_138634.2:c.109+613A>G, NW_003871068.1:g.310488T>C

                                Display Settings:

                                Format
                                Items per page
                                Sort by

                                Send to:

                                Choose Destination

                                Supplemental Content

                                Find related data

                                Recent activity

                                Your browsing activity is empty.

                                Activity recording is turned off.

                                Turn recording back on

                                See more...
                                Support Center