Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

1.

rs193922674 [Homo sapiens]
    CTTATAGGATATGTCTCACAAAACA[C/G]ATGCCGACATCAGTGGCTCAGACAG
    Chromosome:
    12:32802557
    Gene:
    PKP2 (GeneView)
    Functional Consequence:
    splice acceptor variant
    Allele Origin:
    G(germline)/C(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by cluster,by frequency
    HGVS:
    NC_000012.11:g.32955491C>G, NC_000012.12:g.32802557C>G, NG_009000.1:g.99290G>C, NM_001005242.2:c.2014-1G>C, NM_004572.3:c.2146-1G>C
    2.

    rs193922672 [Homo sapiens]
      AATATCATCATCCCCTTTTCTGGGT[A/G]GCCTGAAGGAGACTACCCAAAAGCA
      Chromosome:
      12:32841103
      Gene:
      PKP2 (GeneView)
      Functional Consequence:
      stop gained
      Allele Origin:
      G(germline)/A(germline)
      Clinical significance:
      Pathogenic
      Validated:
      by cluster,by frequency
      HGVS:
      NC_000012.11:g.32994037C>T, NC_000012.12:g.32841103C>T, NG_009000.1:g.60744G>A, NM_001005242.2:c.1481G>A, NM_004572.3:c.1613G>A, NP_001005242.2:p.Trp494Ter, NP_004563.2:p.Trp538Ter

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center