Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 19

1.
2.

rs7961581 [Homo sapiens]
    CTGGATGCCAAAGCTCAGGAGTAAA[C/T]GAGGATGAAAAGTAGTTATCAACTC
    Chromosome:
    12:71269322
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.2384/1194
    HGVS:
    NC_000012.11:g.71663102C>T, NC_000012.12:g.71269322C>T
    3.

    rs7901695 [Homo sapiens]
      catataaatggtatcataaaatcta[C/T]gggcttttgtgtctgtctgctttca
      Chromosome:
      10:112994329
      Gene:
      TCF7L2 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.2821/1413
      HGVS:
      NC_000010.10:g.114754088T>C, NC_000010.11:g.112994329T>C, NG_012631.1:g.49080T>C, NM_001146274.1:c.450+29705T>C, NM_001146283.1:c.381+42722T>C, NM_001146284.1:c.381+42722T>C, NM_001146285.1:c.381+42722T>C, NM_001146286.1:c.381+42722T>C, NM_001198525.1:c.381+42722T>C, NM_001198526.1:c.381+42722T>C, NM_001198527.1:c.381+42722T>C, NM_001198528.1:c.381+42722T>C, NM_001198529.1:c.381+42722T>C, NM_001198530.1:c.381+42722T>C, NM_001198531.1:c.450+29705T>C, NM_030756.4:c.381+42722T>C, XM_005270071.1:c.450+29705T>C, XM_005270072.1:c.450+29705T>C, XM_005270073.1:c.450+29705T>C, XM_005270074.1:c.450+29705T>C, XM_005270075.1:c.450+29705T>C, XM_005270076.1:c.450+29705T>C, XM_005270077.1:c.450+29705T>C, XM_005270078.1:c.450+29705T>C, XM_005270079.1:c.450+29705T>C, XM_005270080.1:c.381+42722T>C, XM_005270081.1:c.381+42722T>C, XM_005270082.1:c.450+29705T>C, XM_005270083.1:c.450+29705T>C, XM_005270084.1:c.450+29705T>C, XM_005270085.1:c.450+29705T>C, XM_005270086.1:c.381+42722T>C, XM_005270087.1:c.381+42722T>C, XM_005270088.1:c.381+42722T>C, XM_005270089.1:c.381+42722T>C, XM_005270090.1:c.381+42722T>C, XM_005270091.1:c.450+29705T>C, XM_005270091.2:c.450+29705T>C, XM_005270092.1:c.450+29705T>C, XM_005270093.1:c.450+29705T>C, XM_005270093.2:c.450+29705T>C, XM_005270094.1:c.450+29705T>C, XM_005270094.2:c.450+29705T>C, XM_005270095.1:c.450+29705T>C, XM_005270096.1:c.450+29705T>C, XM_005270096.2:c.450+29705T>C, XM_005270100.1:c.450+29705T>C, XM_005270101.1:c.381+42722T>C, XM_005270101.2:c.381+42722T>C, XM_005270102.1:c.450+29705T>C, XM_005270103.1:c.381+42722T>C, XM_005270104.1:c.381+42722T>C, XM_011540109.1:c.450+29705T>C, XM_011540110.1:c.381+42722T>C, XM_011540111.1:c.381+42722T>C, XM_011540113.2:c.450+29705T>C, XM_011540116.1:c.450+29705T>C, XM_017016584.1:c.450+29705T>C, XM_017016585.1:c.450+29705T>C, XM_017016586.1:c.450+29705T>C, XM_017016587.1:c.450+29705T>C, XM_017016588.1:c.381+42722T>C, XM_017016589.1:c.450+29705T>C, XM_017016590.1:c.450+29705T>C, XM_017016591.1:c.450+29705T>C, XM_017016592.1:c.450+29705T>C, XM_017016593.1:c.450+29705T>C, XM_017016594.1:c.381+42722T>C, XM_017016595.1:c.450+29705T>C, XM_017016596.1:c.450+29705T>C
      5.

      rs5015480 [Homo sapiens]
        GAAGTAAACTCGAATGTTGATTATA[C/T]GTTTTCTATCAAATTATTCAAGTAT
        Chromosome:
        10:92705802
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.4549/2278
        HGVS:
        NC_000010.10:g.94465559C>T, NC_000010.11:g.92705802C>T
        6.

        rs4607103 [Homo sapiens]
          ATAATTCCTCAGGCCCAGCAGGTTT[C/T]TCAACTTGACTTTTCTTAGGTTATT
          Chromosome:
          3:64726228
          Gene:
          ADAMTS9-AS2 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency
          Global MAF:
          T=0.3540/1773
          HGVS:
          NC_000003.11:g.64711904C>T, NC_000003.12:g.64726228C>T, NR_038264.1:n.469+40890C>T
          8.

          rs2237892 [Homo sapiens]
            GGAGCTGTCACAGGACTTTGCCACC[C/T]GGGGTGAGGGGCCTAGAAACCCCTC
            Chromosome:
            11:2818521
            Gene:
            KCNQ1 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.1490/746
            HGVS:
            NC_000011.10:g.2818521C>T, NC_000011.9:g.2839751C>T, NG_008935.1:g.378531C>T, NM_000218.2:c.1795-29246C>T, NM_181798.1:c.1414-29246C>T, NR_040711.2:n.1688-29246C>T, NT_187585.1:g.50708C>T
            9.

            rs1801282 [Homo sapiens]
              AACTCTGGGAGATTCTCCTATTGAC[C/G]CAGAAAGCGATTCCTTCACTGATAC
              Chromosome:
              3:12351626
              Gene:
              PPARG (GeneView)
              Functional Consequence:
              intron variant,missense
              Allele Origin:
              G(germline)/C(germline)
              Clinical significance:
              Likely benign
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.0703/352
              HGVS:
              NC_000003.11:g.12393125C>G, NC_000003.12:g.12351626C>G, NG_011749.1:g.68777C>G, NM_001330615.1:c.-2-28078C>G, NM_005037.5:c.-2-28078C>G, NM_015869.4:c.34C>G, NM_138711.3:c.-2-28078C>G, NM_138712.3:c.-2-28078C>G, NP_056953.2:p.Pro12Ala, XM_011533841.2:c.-2-28078C>G, XM_011533842.2:c.34C>G, XM_011533843.2:c.34C>G, XM_011533844.1:c.-2-28078C>G, XP_011532144.1:p.Pro12Ala, XP_011532145.1:p.Pro12Ala
              10.

              rs1326663 [Homo sapiens]
                AGCTGGTAGGCGTAGAGATGAGTGG[A/G]CATTTTGATCCAGTGAGGGGTATTG
                Chromosome:
                10:120420014
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                G=0.3542/1774
                HGVS:
                NC_000010.10:g.122179526A>G, NC_000010.11:g.120420014A>G
                11.

                rs1277979 [Homo sapiens]
                  ttctttctttctttcctttctttct[C/T]tttctttttctttctttctttcttt
                  Chromosome:
                  X:68904002
                  Validated:
                  no info
                  HGVS:
                  NC_000023.10:g.68123845C>T, NC_000023.11:g.68904002C>T
                  12.

                  rs1081166 [Homo sapiens]
                    ttctatgcatgtaagcacatgaagc[A/C]cagctgaacaatggcaacatcttcc
                    Chromosome:
                    22:12203070
                    Validated:
                    by cluster,by hapmap
                    HGVS:
                    NC_000001.10:g.142916288A>C, NC_000022.11:g.12203070A>C
                    14.

                    rs864745 [Homo sapiens]
                      ATTTCCTACAACCATTCAAAACATT[A/G]TAACAGTTCAAATTATATTTGAGCA
                      Chromosome:
                      7:28140937
                      Gene:
                      JAZF1 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      C=0.3027/1516
                      HGVS:
                      NC_000007.13:g.28180556T>C, NC_000007.14:g.28140937T>C, NG_011499.1:g.44882A>G, NM_175061.3:c.115+39526A>G, XM_006715656.1:c.-140+39526A>G, XM_017011832.1:c.-78+38893A>G
                      16.

                      rs286628 [Homo sapiens]
                        tgctatttgttgcctgtgtaccttg[G/T]ttttttgtttttgttttttaaattg
                        Chromosome:
                        5:155037420
                        Validated:
                        by 1000G,by cluster,by frequency
                        Global MAF:
                        T=0.3886/1946
                        HGVS:
                        NC_000005.10:g.155037420G>T, NC_000005.9:g.154416980G>T
                        17.

                        rs268147 [Homo sapiens]
                          tggcctcactgtttatgggtagttg[C/T]ggcagtggctgtcttagtgtcagag
                          Chromosome:
                          5:126224886
                          Validated:
                          by 1000G,by cluster,by frequency,by hapmap
                          Global MAF:
                          T=0.0563/282
                          HGVS:
                          NC_000005.10:g.126224886T>C, NC_000005.9:g.125560579T>C
                          18.

                          rs189848 [Homo sapiens]
                            cagcttcttcctgttaccttgggag[A/G]gtgtatatgtccaggaatttatcca
                            Chromosome:
                            5:53662727
                            Gene:
                            NDUFS4 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by cluster,by frequency
                            Global MAF:
                            A=0.2915/1460
                            HGVS:
                            NC_000005.10:g.53662727G>A, NC_000005.9:g.52958557G>A, NG_008200.1:g.107093G>A, NM_001318051.1:c.350+16322G>A, NM_002495.3:c.424+4103G>A, NR_134473.1:n.626+4103G>A, NR_134474.1:n.543+4103G>A, NR_134475.1:n.578+4103G>A, XM_005248525.1:c.350+16322G>A
                            19.

                            rs5219 [Homo sapiens]
                              CGCTGGCGGGCACGGTACCTGGGCT[C/T]GGCAGGGTCCTCTGCCAGGCGTGTC
                              Chromosome:
                              11:17388025
                              Gene:
                              KCNJ11 (GeneView)
                              Functional Consequence:
                              intron variant,missense
                              Allele Origin:
                              T(germline)/C(germline)
                              Clinical significance:
                              drug-response
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency
                              Global MAF:
                              T=0.2630/1317
                              HGVS:
                              NC_000011.10:g.17388025T>C, NC_000011.9:g.17409572T>C, NG_012446.1:g.5635A>G, NM_000525.3:c.67A>G, NM_001166290.1:c.-16-179A>G, NP_000516.3:p.Lys23Glu, XM_005252910.1:c.67A>G, XM_006718226.3:c.-16-179A>G, XM_017017680.1:c.-16-179A>G, XP_005252967.1:p.Lys23Glu

                              Display Settings:

                              Format
                              Items per page
                              Sort by

                              Send to:

                              Choose Destination

                              Supplemental Content

                              Find related data

                              Recent activity

                              Your browsing activity is empty.

                              Activity recording is turned off.

                              Turn recording back on

                              See more...
                              Support Center