Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 7

1.

rs11981433 [Homo sapiens]
    AGACTGCAAAGAAGCCAAGAGAAAA[C/T]GGCATTGCTCAGAGCCTGACACACC
    Chromosome:
    7:95425028
    Gene:
    PON2 (GeneView)
    Functional Consequence:
    intron variant,upstream variant 2KB
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.2165/1084
    HGVS:
    NC_000007.13:g.95054340T>C, NC_000007.14:g.95425028T>C, NG_008725.1:g.15045A>G, NM_000305.2:c.75-443A>G, NM_001018161.1:c.75-443A>G, XM_005250453.1:c.-104-443A>G, XM_005250454.1:c.-180-443A>G, XM_017012357.1:c.-623A>G, XM_017012358.1:c.-697A>G, XR_242249.1:n.448-443A>G
    2.

    rs10487132 [Homo sapiens]
      ATTAGCCTATGCACAACTATCATTA[A/G]AATCCCACTGCTAAGTCTAAAATCA
      Chromosome:
      7:95390993
      Gene:
      PON3 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.1755/879
      HGVS:
      NC_000007.13:g.95020305A>G, NC_000007.14:g.95390993A>G, NG_008726.1:g.10383T>C, NM_000940.2:c.146-784T>C, XM_005250455.1:c.146-784T>C, XM_005250456.1:c.146-784T>C
      3.

      rs854560 [Homo sapiens]
        GCCAGTCCATTAGGCAGTATCTCCA[A/C/G/N/T]GTCTTCAGAGCCAGTTTCTGCCAGA
        Chromosome:
        7:95316772
        Gene:
        PON1 (GeneView)
        Functional Consequence:
        missense
        Allele Origin:
        T(germline)/A(germline)
        Clinical significance:
        other
        Validated:
        by 1000G,by cluster,by frequency
        Global MAF:
        T=0.1827/915
        HGVS:
        NC_000007.13:g.94946084A>T, NC_000007.14:g.95316772A>T, NG_008779.1:g.12801T>A, NM_000446.5:c.163T>A, NP_000437.3:p.Leu55Met
        4.

        rs705381 [Homo sapiens]
          GGGCCGACCAGGTGCACAGAAGGCG[C/T]GGCTTGCGGTCAGCCCCCACCGCAG
          Chromosome:
          7:95324637
          Gene:
          PON1 (GeneView)
          Functional Consequence:
          upstream variant 2KB
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.2570/1287
          HGVS:
          NC_000007.13:g.94953949T>C, NC_000007.14:g.95324637T>C, NG_008779.1:g.4936A>G, NM_000446.5:c.-162A>G
          5.

          rs705379 [Homo sapiens]
            GGGGCAGCGCCGATTGGCCCGCCCC[A/G]CCCCTCCCCGCCGGGTCGGCAGCTA
            Chromosome:
            7:95324583
            Gene:
            PON1 (GeneView)
            Functional Consequence:
            upstream variant 2KB
            Allele Origin:
            G(germline)/A(germline)
            Clinical significance:
            other
            Validated:
            by 1000G,by cluster,by frequency
            Global MAF:
            A=0.3490/1748
            HGVS:
            NC_000007.13:g.94953895G>A, NC_000007.14:g.95324583G>A, NG_008779.1:g.4990C>T, NM_000446.5:c.-108C>T
            7.

            rs662 [Homo sapiens]
              CACTATTTTCTTGACCCCTACTTAC[A/G]ATCCTGGGAGATGTATTTGGGTTTA
              Chromosome:
              7:95308134
              Gene:
              PON1 (GeneView)
              Functional Consequence:
              missense
              Allele Origin:
              G(germline)/A(germline)
              Clinical significance:
              other
              Validated:
              by 1000G,by cluster,by frequency,by hapmap,by submitter
              Global MAF:
              T=0.4571/2289
              HGVS:
              NC_000007.13:g.94937446T>C, NC_000007.14:g.95308134T>C, NG_008779.1:g.21439A>G, NM_000446.5:c.575A>G, NP_000437.3:p.Gln192Arg

              Display Settings:

              Format
              Items per page
              Sort by

              Send to:

              Choose Destination

              Supplemental Content

              Find related data

              Recent activity

              Your browsing activity is empty.

              Activity recording is turned off.

              Turn recording back on

              See more...
              Support Center