Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 7

1.

rs9934438 [Homo sapiens]
    CCCCGACCTCCCATCCTAGTCCAAG[A/G]GTCGATGATCTCCTGGCACCGGGCA
    Chromosome:
    16:31093557
    Gene:
    VKORC1 (GeneView)
    Functional Consequence:
    intron variant
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    drug-response
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.3558/1782
    HGVS:
    NC_000016.10:g.31093557G>A, NC_000016.9:g.31104878G>A, NG_011564.1:g.6399C>T, NM_001311311.1:c.174-136C>T, NM_024006.5:c.174-136C>T, NM_206824.2:c.173+1000C>T, XM_005255568.1:c.174-136C>T, XR_243303.1:n.823-236C>T
    3.

    rs4917639 [Homo sapiens]
      TAATGCTATTATGAATATGGGTAAA[A/C]AAATATCTCTTTGATGTGCTGCTTT
      Chromosome:
      10:94965778
      Gene:
      CYP2C9 (GeneView)
      Functional Consequence:
      intron variant
      Clinical significance:
      drug-response
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.1639/821
      HGVS:
      NC_000010.10:g.96725535A>C, NC_000010.11:g.94965778A>C, NG_008385.1:g.32121A>C, NM_000771.3:c.820-6326A>C, XM_005269575.1:c.820-6326A>C, XM_017015758.1:c.820-6326A>C
      4.

      rs2359612 [Homo sapiens]
        TCTGAACCATGTGTCAGCCAGGACC[A/G]TGGTGCTGGGCCTCCCTCAGTGATG
        Chromosome:
        16:31092475
        Gene:
        VKORC1 (GeneView)
        Functional Consequence:
        intron variant
        Clinical significance:
        drug-response
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.3904/1955
        HGVS:
        NC_000016.10:g.31092475A>G, NC_000016.9:g.31103796A>G, NG_011564.1:g.7481T>C, NM_001311311.1:c.367+308T>C, NM_024006.5:c.283+837T>C, NM_206824.2:c.174-1133T>C, XM_005255568.1:c.367+308T>C, XR_243303.1:n.832+837T>C
        5.

        rs2108622 [Homo sapiens]
          CCCCGCACCTCAGGGTCCGGCCACA[C/T]AGCTGGGTTGTGATGGGTTCCGAAA
          Chromosome:
          19:15879621
          Gene:
          CYP4F2 (GeneView)
          Functional Consequence:
          missense
          Clinical significance:
          drug-response
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.2368/1186
          HGVS:
          NC_000019.10:g.15879621C>T, NC_000019.9:g.15990431C>T, NG_007971.2:g.23454G>A, NM_001082.4:c.1297G>A, NP_001073.3:p.Val433Met

          Display Settings:

          Format
          Items per page
          Sort by

          Send to:

          Choose Destination

          Supplemental Content

          Find related data

          Recent activity

          Your browsing activity is empty.

          Activity recording is turned off.

          Turn recording back on

          See more...
          Support Center