Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 5

2.
3.

rs3816334 [Homo sapiens]
    TGAAAGCTCTTCAGCAGCAGCAGCA[A/G]CAGCAACAGCAGAAACTCTCAGGTT
    Chromosome:
    2:232844096
    Gene:
    GIGYF2 (GeneView)
    Functional Consequence:
    nc transcript variant,synonymous codon
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.3596/1801
    HGVS:
    NC_000002.11:g.233708806A>G, NC_000002.12:g.232844096A>G, NG_011847.1:g.151792A>G, NM_001103146.1:c.2940A>G, NM_001103147.1:c.3003A>G, NM_001103148.1:c.2922A>G, NM_015575.3:c.2940A>G, NP_001096616.1:p.Gln980, NP_001096617.1:p.Gln1001, NP_001096618.1:p.Gln974, NP_056390.2:p.Gln980, NR_103492.1:n.3053A>G
    4.

    rs2305138 [Homo sapiens]
      GAATCGACACTCCTTTAGCTCTGTG[C/T]TCTTGCAGTTTTGATGCCAATCTTT
      Chromosome:
      2:232796136
      Gene:
      GIGYF2 (GeneView)
      Functional Consequence:
      nc transcript variant,synonymous codon
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.1050/526
      HGVS:
      NC_000002.11:g.233660846G>A, NC_000002.12:g.232796136G>A, NG_011847.1:g.103832G>A, NM_001103146.1:c.1554G>A, NM_001103147.1:c.1617G>A, NM_001103148.1:c.1536G>A, NM_015575.3:c.1554G>A, NP_001096616.1:p.Glu518, NP_001096617.1:p.Glu539, NP_001096618.1:p.Glu512, NP_056390.2:p.Glu518, NR_103492.1:n.1667G>A
      5.

      rs2289912 [Homo sapiens]
        GGTGTTTCAACTGGCCGGAGAGTAG[G/T]ACTAGGATTGGGAACAGGAGGTGGA
        Chromosome:
        2:232794843
        Gene:
        GIGYF2 (GeneView)
        Functional Consequence:
        missense,nc transcript variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.0831/416
        HGVS:
        NC_000002.11:g.233659553C>A, NC_000002.12:g.232794843C>A, NG_011847.1:g.102539C>A, NM_001103146.1:c.1378C>A, NM_001103147.1:c.1441C>A, NM_001103148.1:c.1360C>A, NM_015575.3:c.1378C>A, NP_001096616.1:p.Pro460Thr, NP_001096617.1:p.Pro481Thr, NP_001096618.1:p.Pro454Thr, NP_056390.2:p.Pro460Thr, NR_103492.1:n.1491C>A

        Display Settings:

        Format
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Support Center