Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 4

3.

rs3807213 [Homo sapiens]
    TGTAGATCTATACAACCTCAGGCAG[A/C]ACTACATTAGCAATCTGTCTCAGGC
    Chromosome:
    7:112465699
    Gene:
    IFRD1 (GeneView)
    Functional Consequence:
    intron variant,nc transcript variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.4786/2397
    HGVS:
    NC_000007.13:g.112105754G>T, NC_000007.14:g.112465699G>T, NG_027799.1:g.47556G>T, NM_001007245.2:c.907-2282G>T, NM_001197079.1:c.757-2282G>T, NM_001197080.1:c.757-2282G>T, NM_001550.3:c.907-2282G>T, NR_120333.1:n.930-2282G>T, XM_011516142.2:c.907-125G>T, XM_011516143.2:c.757-125G>T, XM_017012151.1:c.757-2282G>T, XR_001744703.1:n.1163-2282G>T, XR_001744704.1:n.1223G>T, XR_927462.2:n.1163-125G>T, XR_927463.2:n.1054-2282G>T

    Display Settings:

    Format
    Sort by

    Send to:

    Choose Destination

    Supplemental Content

    Find related data

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center