Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 4

1.

rs12255372 [Homo sapiens]
    TGCCCAGGAATATCCAGGCAAGAAT[A/G/T]ACCATATTCTGATAATTACTCAGGC
    Chromosome:
    10:113049143
    Gene:
    TCF7L2 (GeneView)
    Functional Consequence:
    intron variant
    Allele Origin:
    G(germline)/T(germline)
    Clinical significance:
    other
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.2139/1071
    HGVS:
    NC_000010.10:g.114808902G>A, NC_000010.10:g.114808902G>T, NC_000010.11:g.113049143G>A, NC_000010.11:g.113049143G>T, NG_012631.1:g.103894G>A, NG_012631.1:g.103894G>T, NM_001146274.1:c.552+9017G>A, NM_001146274.1:c.552+9017G>T, NM_001146283.1:c.483+9017G>A, NM_001146283.1:c.483+9017G>T, NM_001146284.1:c.483+9017G>A, NM_001146284.1:c.483+9017G>T, NM_001146285.1:c.483+9017G>A, NM_001146285.1:c.483+9017G>T, NM_001146286.1:c.483+9017G>A, NM_001146286.1:c.483+9017G>T, NM_001198525.1:c.483+9017G>A, NM_001198525.1:c.483+9017G>T, NM_001198526.1:c.483+9017G>A, NM_001198526.1:c.483+9017G>T, NM_001198527.1:c.483+9017G>A, NM_001198527.1:c.483+9017G>T, NM_001198528.1:c.483+9017G>A, NM_001198528.1:c.483+9017G>T, NM_001198529.1:c.483+9017G>A, NM_001198529.1:c.483+9017G>T, NM_001198530.1:c.382-92041G>A, NM_001198530.1:c.382-92041G>T, NM_001198531.1:c.552+9017G>A, NM_001198531.1:c.552+9017G>T, NM_030756.4:c.483+9017G>A, NM_030756.4:c.483+9017G>T, XM_005270071.1:c.552+9017G>A, XM_005270071.1:c.552+9017G>T, XM_005270072.1:c.552+9017G>A, XM_005270072.1:c.552+9017G>T, XM_005270073.1:c.552+9017G>A, XM_005270073.1:c.552+9017G>T, XM_005270074.1:c.552+9017G>A, XM_005270074.1:c.552+9017G>T, XM_005270075.1:c.552+9017G>A, XM_005270075.1:c.552+9017G>T, XM_005270076.1:c.552+9017G>A, XM_005270076.1:c.552+9017G>T, XM_005270077.1:c.552+9017G>A, XM_005270077.1:c.552+9017G>T, XM_005270078.1:c.552+9017G>A, XM_005270078.1:c.552+9017G>T, XM_005270079.1:c.552+9017G>A, XM_005270079.1:c.552+9017G>T, XM_005270080.1:c.483+9017G>A, XM_005270080.1:c.483+9017G>T, XM_005270081.1:c.483+9017G>A, XM_005270081.1:c.483+9017G>T, XM_005270082.1:c.552+9017G>A, XM_005270082.1:c.552+9017G>T, XM_005270083.1:c.552+9017G>A, XM_005270083.1:c.552+9017G>T, XM_005270084.1:c.552+9017G>A, XM_005270084.1:c.552+9017G>T, XM_005270085.1:c.552+9017G>A, XM_005270085.1:c.552+9017G>T, XM_005270086.1:c.483+9017G>A, XM_005270086.1:c.483+9017G>T, XM_005270087.1:c.483+9017G>A, XM_005270087.1:c.483+9017G>T, XM_005270088.1:c.483+9017G>A, XM_005270088.1:c.483+9017G>T, XM_005270089.1:c.483+9017G>A, XM_005270089.1:c.483+9017G>T, XM_005270090.1:c.382-92041G>A, XM_005270090.1:c.382-92041G>T, XM_005270091.1:c.552+9017G>A, XM_005270091.1:c.552+9017G>T, XM_005270091.2:c.552+9017G>A, XM_005270091.2:c.552+9017G>T, XM_005270092.1:c.552+9017G>A, XM_005270092.1:c.552+9017G>T, XM_005270093.1:c.552+9017G>A, XM_005270093.1:c.552+9017G>T, XM_005270093.2:c.552+9017G>A, XM_005270093.2:c.552+9017G>T, XM_005270094.1:c.552+9017G>A, XM_005270094.1:c.552+9017G>T, XM_005270094.2:c.552+9017G>A, XM_005270094.2:c.552+9017G>T, XM_005270095.1:c.552+9017G>A, XM_005270095.1:c.552+9017G>T, XM_005270096.1:c.552+9017G>A, XM_005270096.1:c.552+9017G>T, XM_005270096.2:c.552+9017G>A, XM_005270096.2:c.552+9017G>T, XM_005270100.1:c.552+9017G>A, XM_005270100.1:c.552+9017G>T, XM_005270101.1:c.483+9017G>A, XM_005270101.1:c.483+9017G>T, XM_005270101.2:c.483+9017G>A, XM_005270101.2:c.483+9017G>T, XM_005270102.1:c.552+9017G>A, XM_005270102.1:c.552+9017G>T, XM_005270103.1:c.483+9017G>A, XM_005270103.1:c.483+9017G>T, XM_005270104.1:c.483+9017G>A, XM_005270104.1:c.483+9017G>T, XM_011540109.1:c.552+9017G>A, XM_011540109.1:c.552+9017G>T, XM_011540110.1:c.483+9017G>A, XM_011540110.1:c.483+9017G>T, XM_011540111.1:c.483+9017G>A, XM_011540111.1:c.483+9017G>T, XM_011540113.2:c.552+9017G>A, XM_011540113.2:c.552+9017G>T, XM_011540116.1:c.552+9017G>A, XM_011540116.1:c.552+9017G>T, XM_017016584.1:c.552+9017G>A, XM_017016584.1:c.552+9017G>T, XM_017016585.1:c.552+9017G>A, XM_017016585.1:c.552+9017G>T, XM_017016586.1:c.552+9017G>A, XM_017016586.1:c.552+9017G>T, XM_017016587.1:c.552+9017G>A, XM_017016587.1:c.552+9017G>T, XM_017016588.1:c.483+9017G>A, XM_017016588.1:c.483+9017G>T, XM_017016589.1:c.552+9017G>A, XM_017016589.1:c.552+9017G>T, XM_017016590.1:c.552+9017G>A, XM_017016590.1:c.552+9017G>T, XM_017016591.1:c.552+9017G>A, XM_017016591.1:c.552+9017G>T, XM_017016592.1:c.552+9017G>A, XM_017016592.1:c.552+9017G>T, XM_017016593.1:c.552+9017G>A, XM_017016593.1:c.552+9017G>T, XM_017016594.1:c.483+9017G>A, XM_017016594.1:c.483+9017G>T, XM_017016595.1:c.552+9017G>A, XM_017016595.1:c.552+9017G>T, XM_017016596.1:c.552+9017G>A, XM_017016596.1:c.552+9017G>T
    2.

    rs11196205 [Homo sapiens]
      GAAAGTTCTCAACATTTATAACTAC[C/G/T]AGCAGTATGTAAGAGAGTTATGGTT
      Chromosome:
      10:113047288
      Gene:
      TCF7L2 (GeneView)
      Functional Consequence:
      intron variant
      Allele Origin:
      G(germline)/C(germline)
      Clinical significance:
      other
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.4429/2218
      HGVS:
      NC_000010.10:g.114807047G>C, NC_000010.10:g.114807047G>T, NC_000010.11:g.113047288G>C, NC_000010.11:g.113047288G>T, NG_012631.1:g.102039G>C, NG_012631.1:g.102039G>T, NM_001146274.1:c.552+7162G>C, NM_001146274.1:c.552+7162G>T, NM_001146283.1:c.483+7162G>C, NM_001146283.1:c.483+7162G>T, NM_001146284.1:c.483+7162G>C, NM_001146284.1:c.483+7162G>T, NM_001146285.1:c.483+7162G>C, NM_001146285.1:c.483+7162G>T, NM_001146286.1:c.483+7162G>C, NM_001146286.1:c.483+7162G>T, NM_001198525.1:c.483+7162G>C, NM_001198525.1:c.483+7162G>T, NM_001198526.1:c.483+7162G>C, NM_001198526.1:c.483+7162G>T, NM_001198527.1:c.483+7162G>C, NM_001198527.1:c.483+7162G>T, NM_001198528.1:c.483+7162G>C, NM_001198528.1:c.483+7162G>T, NM_001198529.1:c.483+7162G>C, NM_001198529.1:c.483+7162G>T, NM_001198530.1:c.382-93896G>C, NM_001198530.1:c.382-93896G>T, NM_001198531.1:c.552+7162G>C, NM_001198531.1:c.552+7162G>T, NM_030756.4:c.483+7162G>C, NM_030756.4:c.483+7162G>T, XM_005270071.1:c.552+7162G>C, XM_005270071.1:c.552+7162G>T, XM_005270072.1:c.552+7162G>C, XM_005270072.1:c.552+7162G>T, XM_005270073.1:c.552+7162G>C, XM_005270073.1:c.552+7162G>T, XM_005270074.1:c.552+7162G>C, XM_005270074.1:c.552+7162G>T, XM_005270075.1:c.552+7162G>C, XM_005270075.1:c.552+7162G>T, XM_005270076.1:c.552+7162G>C, XM_005270076.1:c.552+7162G>T, XM_005270077.1:c.552+7162G>C, XM_005270077.1:c.552+7162G>T, XM_005270078.1:c.552+7162G>C, XM_005270078.1:c.552+7162G>T, XM_005270079.1:c.552+7162G>C, XM_005270079.1:c.552+7162G>T, XM_005270080.1:c.483+7162G>C, XM_005270080.1:c.483+7162G>T, XM_005270081.1:c.483+7162G>C, XM_005270081.1:c.483+7162G>T, XM_005270082.1:c.552+7162G>C, XM_005270082.1:c.552+7162G>T, XM_005270083.1:c.552+7162G>C, XM_005270083.1:c.552+7162G>T, XM_005270084.1:c.552+7162G>C, XM_005270084.1:c.552+7162G>T, XM_005270085.1:c.552+7162G>C, XM_005270085.1:c.552+7162G>T, XM_005270086.1:c.483+7162G>C, XM_005270086.1:c.483+7162G>T, XM_005270087.1:c.483+7162G>C, XM_005270087.1:c.483+7162G>T, XM_005270088.1:c.483+7162G>C, XM_005270088.1:c.483+7162G>T, XM_005270089.1:c.483+7162G>C, XM_005270089.1:c.483+7162G>T, XM_005270090.1:c.382-93896G>C, XM_005270090.1:c.382-93896G>T, XM_005270091.1:c.552+7162G>C, XM_005270091.1:c.552+7162G>T, XM_005270091.2:c.552+7162G>C, XM_005270091.2:c.552+7162G>T, XM_005270092.1:c.552+7162G>C, XM_005270092.1:c.552+7162G>T, XM_005270093.1:c.552+7162G>C, XM_005270093.1:c.552+7162G>T, XM_005270093.2:c.552+7162G>C, XM_005270093.2:c.552+7162G>T, XM_005270094.1:c.552+7162G>C, XM_005270094.1:c.552+7162G>T, XM_005270094.2:c.552+7162G>C, XM_005270094.2:c.552+7162G>T, XM_005270095.1:c.552+7162G>C, XM_005270095.1:c.552+7162G>T, XM_005270096.1:c.552+7162G>C, XM_005270096.1:c.552+7162G>T, XM_005270096.2:c.552+7162G>C, XM_005270096.2:c.552+7162G>T, XM_005270100.1:c.552+7162G>C, XM_005270100.1:c.552+7162G>T, XM_005270101.1:c.483+7162G>C, XM_005270101.1:c.483+7162G>T, XM_005270101.2:c.483+7162G>C, XM_005270101.2:c.483+7162G>T, XM_005270102.1:c.552+7162G>C, XM_005270102.1:c.552+7162G>T, XM_005270103.1:c.483+7162G>C, XM_005270103.1:c.483+7162G>T, XM_005270104.1:c.483+7162G>C, XM_005270104.1:c.483+7162G>T, XM_011540109.1:c.552+7162G>C, XM_011540109.1:c.552+7162G>T, XM_011540110.1:c.483+7162G>C, XM_011540110.1:c.483+7162G>T, XM_011540111.1:c.483+7162G>C, XM_011540111.1:c.483+7162G>T, XM_011540113.2:c.552+7162G>C, XM_011540113.2:c.552+7162G>T, XM_011540116.1:c.552+7162G>C, XM_011540116.1:c.552+7162G>T, XM_017016584.1:c.552+7162G>C, XM_017016584.1:c.552+7162G>T, XM_017016585.1:c.552+7162G>C, XM_017016585.1:c.552+7162G>T, XM_017016586.1:c.552+7162G>C, XM_017016586.1:c.552+7162G>T, XM_017016587.1:c.552+7162G>C, XM_017016587.1:c.552+7162G>T, XM_017016588.1:c.483+7162G>C, XM_017016588.1:c.483+7162G>T, XM_017016589.1:c.552+7162G>C, XM_017016589.1:c.552+7162G>T, XM_017016590.1:c.552+7162G>C, XM_017016590.1:c.552+7162G>T, XM_017016591.1:c.552+7162G>C, XM_017016591.1:c.552+7162G>T, XM_017016592.1:c.552+7162G>C, XM_017016592.1:c.552+7162G>T, XM_017016593.1:c.552+7162G>C, XM_017016593.1:c.552+7162G>T, XM_017016594.1:c.483+7162G>C, XM_017016594.1:c.483+7162G>T, XM_017016595.1:c.552+7162G>C, XM_017016595.1:c.552+7162G>T, XM_017016596.1:c.552+7162G>C, XM_017016596.1:c.552+7162G>T
      3.

      rs7903146 [Homo sapiens]
        TAGAGAGCTAAGCACTTTTTAGATA[C/T]TATATAATTTAATTGCCGTATGAGG
        Chromosome:
        10:112998590
        Gene:
        TCF7L2 (GeneView)
        Functional Consequence:
        intron variant
        Allele Origin:
        T(germline)/C(germline)
        Clinical significance:
        drug-response
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.2278/1141
        HGVS:
        NC_000010.10:g.114758349C>T, NC_000010.11:g.112998590C>T, NG_012631.1:g.53341C>T, NM_001146274.1:c.450+33966C>T, NM_001146283.1:c.382-41435C>T, NM_001146284.1:c.382-41435C>T, NM_001146285.1:c.382-41435C>T, NM_001146286.1:c.382-41435C>T, NM_001198525.1:c.382-41435C>T, NM_001198526.1:c.382-41435C>T, NM_001198527.1:c.382-41435C>T, NM_001198528.1:c.382-41435C>T, NM_001198529.1:c.382-41435C>T, NM_001198530.1:c.381+46983C>T, NM_001198531.1:c.450+33966C>T, NM_030756.4:c.382-41435C>T, XM_005270071.1:c.450+33966C>T, XM_005270072.1:c.450+33966C>T, XM_005270073.1:c.450+33966C>T, XM_005270074.1:c.450+33966C>T, XM_005270075.1:c.450+33966C>T, XM_005270076.1:c.450+33966C>T, XM_005270077.1:c.450+33966C>T, XM_005270078.1:c.450+33966C>T, XM_005270079.1:c.450+33966C>T, XM_005270080.1:c.382-41435C>T, XM_005270081.1:c.382-41435C>T, XM_005270082.1:c.450+33966C>T, XM_005270083.1:c.450+33966C>T, XM_005270084.1:c.450+33966C>T, XM_005270085.1:c.450+33966C>T, XM_005270086.1:c.382-41435C>T, XM_005270087.1:c.382-41435C>T, XM_005270088.1:c.382-41435C>T, XM_005270089.1:c.382-41435C>T, XM_005270090.1:c.381+46983C>T, XM_005270091.1:c.450+33966C>T, XM_005270091.2:c.450+33966C>T, XM_005270092.1:c.450+33966C>T, XM_005270093.1:c.450+33966C>T, XM_005270093.2:c.450+33966C>T, XM_005270094.1:c.450+33966C>T, XM_005270094.2:c.450+33966C>T, XM_005270095.1:c.450+33966C>T, XM_005270096.1:c.450+33966C>T, XM_005270096.2:c.450+33966C>T, XM_005270100.1:c.450+33966C>T, XM_005270101.1:c.382-41435C>T, XM_005270101.2:c.382-41435C>T, XM_005270102.1:c.450+33966C>T, XM_005270103.1:c.382-41435C>T, XM_005270104.1:c.382-41435C>T, XM_011540109.1:c.450+33966C>T, XM_011540110.1:c.382-41435C>T, XM_011540111.1:c.382-41435C>T, XM_011540113.2:c.450+33966C>T, XM_011540116.1:c.450+33966C>T, XM_017016584.1:c.450+33966C>T, XM_017016585.1:c.450+33966C>T, XM_017016586.1:c.450+33966C>T, XM_017016587.1:c.450+33966C>T, XM_017016588.1:c.382-41435C>T, XM_017016589.1:c.450+33966C>T, XM_017016590.1:c.450+33966C>T, XM_017016591.1:c.450+33966C>T, XM_017016592.1:c.450+33966C>T, XM_017016593.1:c.450+33966C>T, XM_017016594.1:c.382-41435C>T, XM_017016595.1:c.450+33966C>T, XM_017016596.1:c.450+33966C>T
        4.

        rs7901695 [Homo sapiens]
          catataaatggtatcataaaatcta[C/T]gggcttttgtgtctgtctgctttca
          Chromosome:
          10:112994329
          Gene:
          TCF7L2 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.2821/1413
          HGVS:
          NC_000010.10:g.114754088T>C, NC_000010.11:g.112994329T>C, NG_012631.1:g.49080T>C, NM_001146274.1:c.450+29705T>C, NM_001146283.1:c.381+42722T>C, NM_001146284.1:c.381+42722T>C, NM_001146285.1:c.381+42722T>C, NM_001146286.1:c.381+42722T>C, NM_001198525.1:c.381+42722T>C, NM_001198526.1:c.381+42722T>C, NM_001198527.1:c.381+42722T>C, NM_001198528.1:c.381+42722T>C, NM_001198529.1:c.381+42722T>C, NM_001198530.1:c.381+42722T>C, NM_001198531.1:c.450+29705T>C, NM_030756.4:c.381+42722T>C, XM_005270071.1:c.450+29705T>C, XM_005270072.1:c.450+29705T>C, XM_005270073.1:c.450+29705T>C, XM_005270074.1:c.450+29705T>C, XM_005270075.1:c.450+29705T>C, XM_005270076.1:c.450+29705T>C, XM_005270077.1:c.450+29705T>C, XM_005270078.1:c.450+29705T>C, XM_005270079.1:c.450+29705T>C, XM_005270080.1:c.381+42722T>C, XM_005270081.1:c.381+42722T>C, XM_005270082.1:c.450+29705T>C, XM_005270083.1:c.450+29705T>C, XM_005270084.1:c.450+29705T>C, XM_005270085.1:c.450+29705T>C, XM_005270086.1:c.381+42722T>C, XM_005270087.1:c.381+42722T>C, XM_005270088.1:c.381+42722T>C, XM_005270089.1:c.381+42722T>C, XM_005270090.1:c.381+42722T>C, XM_005270091.1:c.450+29705T>C, XM_005270091.2:c.450+29705T>C, XM_005270092.1:c.450+29705T>C, XM_005270093.1:c.450+29705T>C, XM_005270093.2:c.450+29705T>C, XM_005270094.1:c.450+29705T>C, XM_005270094.2:c.450+29705T>C, XM_005270095.1:c.450+29705T>C, XM_005270096.1:c.450+29705T>C, XM_005270096.2:c.450+29705T>C, XM_005270100.1:c.450+29705T>C, XM_005270101.1:c.381+42722T>C, XM_005270101.2:c.381+42722T>C, XM_005270102.1:c.450+29705T>C, XM_005270103.1:c.381+42722T>C, XM_005270104.1:c.381+42722T>C, XM_011540109.1:c.450+29705T>C, XM_011540110.1:c.381+42722T>C, XM_011540111.1:c.381+42722T>C, XM_011540113.2:c.450+29705T>C, XM_011540116.1:c.450+29705T>C, XM_017016584.1:c.450+29705T>C, XM_017016585.1:c.450+29705T>C, XM_017016586.1:c.450+29705T>C, XM_017016587.1:c.450+29705T>C, XM_017016588.1:c.381+42722T>C, XM_017016589.1:c.450+29705T>C, XM_017016590.1:c.450+29705T>C, XM_017016591.1:c.450+29705T>C, XM_017016592.1:c.450+29705T>C, XM_017016593.1:c.450+29705T>C, XM_017016594.1:c.381+42722T>C, XM_017016595.1:c.450+29705T>C, XM_017016596.1:c.450+29705T>C

          Display Settings:

          Format
          Sort by

          Send to:

          Choose Destination

          Supplemental Content

          Find related data

          Recent activity

          Your browsing activity is empty.

          Activity recording is turned off.

          Turn recording back on

          See more...
          Support Center