Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 35

1.

rs17808412 [Homo sapiens]
    TCTCCATTATCGGTGACAACTTTCA[C/G]AGGACTACAAATCCAGTGTCGCTTG
    Chromosome:
    3:107420463
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.0258/129
    HGVS:
    NC_000003.11:g.107139310G>C, NC_000003.12:g.107420463G>C, XR_241538.1:n.238+728C>G, XR_241539.1:n.238+728C>G
    2.

    rs17795186 [Homo sapiens]
      GCAAGTCAGAGCGGGTAACTCAGAA[C/T]TGATTCCCTAAGGCAATTTGGTACT
      Chromosome:
      11:35525184
      Gene:
      PAMR1 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.1617/810
      HGVS:
      NC_000011.10:g.35525184T>C, NC_000011.9:g.35546732T>C, NM_001001991.2:c.73+329A>G, NM_001282675.1:c.-155+3768A>G, NM_001282676.1:c.73+329A>G, NM_015430.3:c.73+329A>G, XM_005252849.1:c.-155+3768A>G, XM_005252850.1:c.73+329A>G
      3.

      rs17763463 [Homo sapiens]
        TCACTAGGAACTGGCTCTCCTAGAA[C/T]ACAACTAATAACACTAAAAGGATGA
        Chromosome:
        2:24033201
        Gene:
        FKBP1B (GeneView) WDCP (GeneView)
        Functional Consequence:
        intron variant,upstream variant 2KB
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.0761/381
        HGVS:
        NC_000002.11:g.24256071T>C, NC_000002.12:g.24033201T>C, NM_001142319.1:c.1819-2039A>G, NM_025203.2:c.1819-255A>G, XM_017003594.1:c.-107T>C, XM_017005029.1:c.*16-255A>G
        4.

        rs17667845 [Homo sapiens]
          CTTACTGCAATTGATATCAAAATTT[C/T]GGAATAAATCTTCTGCTTAAAACTT
          Chromosome:
          5:30936683
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.2698/1351
          HGVS:
          NC_000005.10:g.30936683C>T, NC_000005.9:g.30936790C>T
          5.

          rs17604706 [Homo sapiens]
            TAAAACTTTCAAATGATTATGGAAA[C/T]GATTCTTTAAAGTTGGAGGGAAGTC
            Chromosome:
            5:30936726
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            HGVS:
            NC_000005.10:g.30936726C>T, NC_000005.9:g.30936833C>T
            6.

            rs16919696 [Homo sapiens]
              AAATTAGCATGATGAAAAAAGAATG[A/G]AAATGCCAAAAAAAAAAAGAGAGAA
              Chromosome:
              8:82847327
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              A=0.0381/191
              HGVS:
              NC_000008.10:g.83759562G>A, NC_000008.11:g.82847327G>A
              7.

              rs16836421 [Homo sapiens]
                ATTATCTCCATTATATAGATGTGAA[A/G]CAGGCTCAGATATTTCAACTGATTT
                Chromosome:
                1:238137437
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                G=0.0573/287
                HGVS:
                NC_000001.10:g.238300737A>G, NC_000001.11:g.238137437A>G
                8.

                rs16836417 [Homo sapiens]
                  TTTCACTTTCGTAAATTCCTTAACA[A/C]TTTTAGAGAATAAATAAAAGCTCAG
                  Chromosome:
                  1:238136541
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  A=0.0567/284
                  HGVS:
                  NC_000001.10:g.238299841C>A, NC_000001.11:g.238136541C>A
                  9.

                  rs16836403 [Homo sapiens]
                    GAGGGTTAAAATGTAAGGTTTCTCT[A/C]ACAAAGAAGTTGGACATTAACAGCA
                    Chromosome:
                    1:238132629
                    Validated:
                    by 1000G,by cluster,by frequency,by hapmap
                    Global MAF:
                    C=0.0573/287
                    HGVS:
                    NC_000001.10:g.238295929A>C, NC_000001.11:g.238132629A>C
                    10.

                    rs13358399 [Homo sapiens]
                      AATAACTGACAGAATTAATCTAGAA[A/T]AAAGAAACAAATAGAAAAATAAATC
                      Chromosome:
                      5:44148028
                      Validated:
                      by 1000G,by cluster,by frequency,by hapmap
                      Global MAF:
                      T=0.2147/1075
                      HGVS:
                      NC_000005.10:g.44148028A>T, NC_000005.9:g.44148130A>T
                      11.

                      rs12712001 [Homo sapiens]
                        TCTCTAGTTTTGGATTAAGTGAAGA[A/G]CTTTCCAGTTGGAGACTGTTAGGAG
                        Chromosome:
                        2:4373268
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        A=0.1184/593
                        HGVS:
                        NC_000002.11:g.4420858G>A, NC_000002.12:g.4373268G>A
                        12.

                        rs12225692 [Homo sapiens]
                          catctgtatagttatagggatcatc[C/T]gagaatttccctaaatctgccttta
                          Chromosome:
                          11:83218535
                          Gene:
                          ANKRD42 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by cluster,by frequency,by hapmap
                          Global MAF:
                          T=0.1026/514
                          HGVS:
                          NC_000011.10:g.83218535C>T, NC_000011.9:g.82929577C>T, NM_001300972.1:c.587-6320C>T, NM_001300973.1:c.584-6320C>T, NM_001300975.1:c.587-6320C>T, NM_182603.3:c.503-6320C>T, XM_005273967.1:c.587-6320C>T, XM_005273968.1:c.587-6320C>T, XM_005273969.1:c.587-6320C>T, XM_005273970.1:c.503-6320C>T
                          13.

                          rs11957363 [Homo sapiens]
                            CCAGATAATTCTTTGTTGTGAGGGC[A/C/G]TGTACTAAACATTGTAGAATCTTTA
                            Chromosome:
                            5:30931732
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            C=0.2560/1282
                            HGVS:
                            NC_000005.10:g.30931732G>A, NC_000005.10:g.30931732G>C, NC_000005.9:g.30931839G>C
                            14.

                            rs11799391 [Homo sapiens]
                              AGATGCTTTGAAGACAAAACAAGAT[A/C]GTGCACATAGCTTCTCTATGGCTCT
                              Chromosome:
                              1:238136872
                              Validated:
                              by 1000G,by cluster,by frequency,by hapmap
                              Global MAF:
                              C=0.0567/284
                              HGVS:
                              NC_000001.10:g.238300172A>C, NC_000001.11:g.238136872A>C
                              15.

                              rs11677428 [Homo sapiens]
                                tcgttcatgccaaaaatatagcgat[A/G]atctttgatttctttttttccctta
                                Chromosome:
                                2:56328702
                                Gene:
                                CCDC85A (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by cluster,by frequency,by hapmap
                                Global MAF:
                                A=0.1474/738
                                HGVS:
                                NC_000002.11:g.56555837G>A, NC_000002.12:g.56328702G>A, NM_001080433.1:c.1241-14177G>A, XM_005264122.1:c.1241-14177G>A, XM_005264123.1:c.1241-14177G>A, XM_005264124.1:c.1241-14177G>A, XM_005264125.1:c.1241-14177G>A, XM_005264126.1:c.1241-14177G>A, XM_005264127.1:c.1241-55564G>A
                                16.

                                rs10973320 [Homo sapiens]
                                  CTACCCACCTCCCCTCACCCCAGAT[A/T]CTGCCAAGCTGGTGCTTAGGACAGT
                                  Chromosome:
                                  9:37394606
                                  Gene:
                                  LOC105376035 (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by 1000G,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  A=0.0242/121
                                  HGVS:
                                  NC_000009.11:g.37394603T>A, NC_000009.12:g.37394606T>A, XR_001746666.1:n.634-616T>A
                                  17.

                                  rs10906723 [Homo sapiens]
                                    CTTAAATCCCAAACCCATGCACTGT[A/G]TAAGCTGTGATCATGAATTCTCAGG
                                    Chromosome:
                                    10:14637053
                                    Gene:
                                    FAM107B (GeneView)
                                    Functional Consequence:
                                    intron variant
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                    Global MAF:
                                    G=0.1382/692
                                    HGVS:
                                    NC_000010.10:g.14679052G>A, NC_000010.11:g.14637053G>A, NM_001282695.1:c.-123+30581C>T, NM_031453.3:c.469+30581C>T
                                    18.

                                    rs10461692 [Homo sapiens]
                                      CACTTCAGGAAGCTGAGGCTGGCAG[A/G]CAGCTTGAGCTCAGGAGTTCCAGAC
                                      Chromosome:
                                      5:30938286
                                      Validated:
                                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                      Global MAF:
                                      A=0.2306/1155
                                      HGVS:
                                      NC_000005.10:g.30938286G>A, NC_000005.9:g.30938393G>A
                                      19.

                                      rs10193059 [Homo sapiens]
                                        TGCAGGCAGTGCTTTCTCTCCCTAA[C/T]ATGGAGCAGGTGGCCCTTCCTCTGA
                                        Chromosome:
                                        2:239763856
                                        Gene:
                                        LOC150935 (GeneView)
                                        Functional Consequence:
                                        intron variant
                                        Validated:
                                        by 1000G,by cluster,by frequency,by hapmap
                                        Global MAF:
                                        T=0.0375/188
                                        HGVS:
                                        GPC_000000200.1:g.240897554C>T, GPC_000001061.1:g.240601248C>T, NC_000002.11:g.240685550C>T, NC_000002.12:g.239763856C>T, NR_037808.1:n.73+924C>T, NW_011332689.1:g.66953C>T
                                        20.

                                        rs10181725 [Homo sapiens]
                                          CTTTCTGGAGGGCTCAGGCTTTCCC[C/T]CTTGACAGAGAGTCCAAATGCCAAG
                                          Chromosome:
                                          2:239780054
                                          Gene:
                                          LOC150935 (GeneView)
                                          Functional Consequence:
                                          intron variant
                                          Validated:
                                          by 1000G,by cluster,by frequency,by hapmap
                                          Global MAF:
                                          T=0.0389/195
                                          HGVS:
                                          GPC_000000200.1:g.240913752C>T, GPC_000001061.1:g.240617446C>T, NC_000002.11:g.240701748C>T, NC_000002.12:g.239780054C>T, NR_037808.1:n.74-250C>T, NW_011332689.1:g.83151C>T

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center