Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs2289669 [Homo sapiens]
    GGGCTCAGTTTCCACAGTAGCGTGG[A/G]AGTTCCCGGCTAGACAAAGGGGATG
    Chromosome:
    17:19560030
    Gene:
    LOC105371578 (GeneView) SLC47A1 (GeneView)
    Functional Consequence:
    intron variant,nc transcript variant
    Validated:
    by 1000G,by cluster,by frequency,by submitter
    Global MAF:
    A=0.3552/1779
    HGVS:
    CM000679.2:g.19560030G>A, NC_000017.10:g.19463343G>A, NC_000017.11:g.19560030G>A, NM_018242.2:c.922-158G>A, XR_934310.2:n.816C>T

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center