Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 8

1.

rs6032619 [Homo sapiens]
    CCCTGGAAGATTAAAGATGGCTGCA[C/T]GCTCTGTGATACTCCTTTCATATCA
    Chromosome:
    20:45998388
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.1424/713
    HGVS:
    NC_000020.10:g.44627027T>C, NC_000020.11:g.45998388T>C
    2.

    rs2250889 [Homo sapiens]
      AAGCTGGACTCGGTCTTTGAGGAGC[C/G/T]GCTCTCCAAGAAGCTTTTCTTCTTC
      Chromosome:
      20:46013767
      Gene:
      MMP9 (GeneView)
      Functional Consequence:
      missense
      Clinical significance:
      Benign
      Validated:
      by 1000G,by cluster,by frequency,by hapmap,by submitter
      Global MAF:
      G=0.1697/850
      HGVS:
      NC_000020.10:g.44642406G>C, NC_000020.11:g.46013767G>C, NG_011468.1:g.9860G>C, NM_004994.2:c.1721G>C, NP_004985.2:p.Arg574Pro
      4.

      rs1805088 [Homo sapiens]
        CTGGTGCTGGGCTGCTGCTTTGCTG[C/T]CCCCAGACAGCGCCAGTCCACCCTT
        Chromosome:
        20:46008985
        Gene:
        MMP9 (GeneView)
        Functional Consequence:
        missense
        Clinical significance:
        Likely benign
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.0327/164
        HGVS:
        NC_000020.10:g.44637624C>T, NC_000020.11:g.46008985C>T, NG_011468.1:g.5078C>T, NM_004994.2:c.59C>T, NP_004985.2:p.Ala20Val
        5.

        rs679620 [Homo sapiens]
          ATATCTAGAAAACTACTACGACCTC[A/G]AAAAAGATGTGAAACAGTTTGTTAG
          Chromosome:
          11:102842889
          Gene:
          MMP3 (GeneView)
          Functional Consequence:
          missense
          Clinical significance:
          Benign
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.3478/1742
          HGVS:
          NC_000011.10:g.102842889T>C, NC_000011.9:g.102713620T>C, NG_012100.1:g.5723A>G, NM_002422.4:c.133A>G, NP_002413.1:p.Lys45Glu, NW_003871077.1:g.11124T>C
          6.

          rs225889 [Homo sapiens]
            TATTTTGGAATTATAAGCAAAATTG[G/T]TTAGTTGGTTTTAGGTTACTGAATA
            Chromosome:
            14:30001469
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.2608/1306
            HGVS:
            NC_000014.8:g.30470675C>A, NC_000014.9:g.30001469C>A
            7.

            rs17577 [Homo sapiens]
              GACACGCACGACGTCTTCCAGTACC[A/C/G]AGGTGAGGGCTGAGGAGGATCCCTT
              Chromosome:
              20:46014472
              Gene:
              MMP9 (GeneView)
              Functional Consequence:
              missense
              Clinical significance:
              Benign
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              A=0.1909/956
              HGVS:
              NC_000020.10:g.44643111G>A, NC_000020.11:g.46014472G>A, NG_011468.1:g.10565G>A, NM_004994.2:c.2003G>A, NP_004985.2:p.Arg668Gln
              8.

              rs17576 [Homo sapiens]
                CTCCTCGCCCCAGGACTCTACACCC[A/G]GGACGGCAATGCTGATGGGAAACCC
                Chromosome:
                20:46011586
                Gene:
                MMP9 (GeneView)
                Functional Consequence:
                missense
                Clinical significance:
                Benign
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                G=0.4555/2281
                HGVS:
                NC_000020.10:g.44640225A>G, NC_000020.11:g.46011586A>G, NG_011468.1:g.7679A>G, NM_004994.2:c.836A>G, NP_004985.2:p.Gln279Arg

                Display Settings:

                Format
                Items per page
                Sort by

                Send to:

                Choose Destination

                Supplemental Content

                Find related data

                Recent activity

                Your browsing activity is empty.

                Activity recording is turned off.

                Turn recording back on

                See more...
                Support Center