Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs2070235 [Homo sapiens]
    GGCTCTGTCCCCTGTCACTGAGAAT[A/G]GCACCAGTCTGTCCTTCCTGGATTC
    Chromosome:
    20:43702817
    Gene:
    MYBL2 (GeneView)
    Functional Consequence:
    missense
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
    Global MAF:
    G=0.1565/784
    HGVS:
    NC_000020.10:g.42331457A>G, NC_000020.11:g.43702817A>G, NM_001278610.1:c.1207A>G, NM_002466.3:c.1279A>G, NP_001265539.1:p.Ser403Gly, NP_002457.1:p.Ser427Gly

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center