Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 39

1.

rs16907654 [Homo sapiens]
    GAGCTCAAATAAAGAGCACTGGAGC[A/G/T]TTAATATAGTCATAAGCTTAGATGG
    Chromosome:
    11:10323889
    Gene:
    CAND1.11 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    G=0.0617/309
    HGVS:
    CM000673.2:g.10323889A>G, CM000673.2:g.10323889A>T, NC_000011.10:g.10323889A>G, NC_000011.10:g.10323889A>T, NC_000011.9:g.10345436A>G, NR_103765.1:n.362-6681A>G, NR_103765.1:n.362-6681A>T
    2.

    rs12449568 [Homo sapiens]
      GAAACTATCAACCCACAGGAGCTAG[C/T]AGATATTTGGAAATAAGGAAGTAAC
      Chromosome:
      17:56352794
      Gene:
      ANKFN1 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.4048/2027
      HGVS:
      CM000679.2:g.56352794C>T, NC_000017.10:g.54430155C>T, NC_000017.11:g.56352794C>T, NM_153228.2:c.400-1042C>T
      3.

      rs12288355 [Homo sapiens]
        TAGAAAATAATAAACATATAACATC[A/C/G]AGAAAAAGAATGTGAGAGTTTAGAT
        Chromosome:
        11:10051302
        Gene:
        SBF2 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency
        Global MAF:
        C=0.4509/2258
        HGVS:
        CM000673.2:g.10051302G>A, CM000673.2:g.10051302G>C, NC_000011.10:g.10051302G>A, NC_000011.10:g.10051302G>C, NC_000011.9:g.10072849G>C, NG_008074.1:g.247906C>G, NG_008074.1:g.247906C>T, NM_030962.3:c.142-8321C>G, NM_030962.3:c.142-8321C>T, XR_001747994.1:n.289-8321C>G, XR_001747994.1:n.289-8321C>T
        4.

        rs11765954 [Homo sapiens]
          TTCTGGGTACCACTTCAGGTGAACA[C/T]TTCTGTGCCAAGATGGCTAACAGGG
          Chromosome:
          7:92651381
          Gene:
          CDK6 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.1522/762
          HGVS:
          CM000669.2:g.92651381T>C, NC_000007.13:g.92280695T>C, NC_000007.14:g.92651381T>C, NG_015888.1:g.190247A>G, NM_001145306.1:c.647+20045A>G, NM_001259.6:c.647+20045A>G, NM_001259.7:c.647+20045A>G
          5.

          rs11607174 [Homo sapiens]
            CTGTGTGTTCATTCCATGTATCTTC[C/T]TTAACTACCTATGATGTACCAGGCA
            Chromosome:
            11:10284481
            Gene:
            SBF2 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.4107/2057
            HGVS:
            CM000673.2:g.10284481C>T, NC_000011.10:g.10284481C>T, NC_000011.9:g.10306028C>T, NG_008074.1:g.14727G>A, NM_030962.3:c.55+9534G>A, XR_001747994.1:n.202+9534G>A
            6.

            rs11205277 [Homo sapiens]
              atcaccacacgaacatctaataagc[A/C/G/T]tatcaaactGGGGCAGCTAGAATTT
              Chromosome:
              1:149920979
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.2520/1262
              HGVS:
              CM000663.2:g.149920979A>C, CM000663.2:g.149920979A>G, CM000663.2:g.149920979A>T, NC_000001.10:g.149892872A>G, NC_000001.11:g.149920979A>C, NC_000001.11:g.149920979A>G, NC_000001.11:g.149920979A>T, NG_050966.1:g.1904T>A, NG_050966.1:g.1904T>C, NG_050966.1:g.1904T>G
              7.

              rs11042717 [Homo sapiens]
                tcacatttttcttcatatttgacaa[C/T]cagctggctactgacaattgccaag
                Chromosome:
                11:10282392
                Gene:
                SBF2 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency
                Global MAF:
                C=0.3536/1771
                HGVS:
                CM000673.2:g.10282392T>C, NC_000011.10:g.10282392T>C, NC_000011.9:g.10303939T>C, NG_008074.1:g.16816A>G, NM_030962.3:c.55+11623A>G, XR_001747994.1:n.202+11623A>G
                8.

                rs11042714 [Homo sapiens]
                  GCAGCTTTGCCTCAGCAAATAAAAG[G/T]ATGAATGATTTGGCAGTGGGAGTTA
                  Chromosome:
                  11:10274104
                  Gene:
                  SBF2 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency
                  Global MAF:
                  G=0.4000/2003
                  HGVS:
                  CM000673.2:g.10274104T>G, NC_000011.10:g.10274104T>G, NC_000011.9:g.10295651T>G, NG_008074.1:g.25104A>C, NM_030962.3:c.55+19911A>C, XR_001747994.1:n.202+19911A>C
                  9.

                  rs11042702 [Homo sapiens]
                    GGACAACAGGACCCAGGCTAGATAC[A/G]GGTAAATGCAGATTTCCTCTGCTAC
                    Chromosome:
                    11:10266441
                    Gene:
                    SBF2 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency
                    Global MAF:
                    A=0.4379/2193
                    HGVS:
                    CM000673.2:g.10266441G>A, NC_000011.10:g.10266441G>A, NC_000011.9:g.10287988G>A, NG_008074.1:g.32767C>T, NM_030962.3:c.55+27574C>T, XR_001747994.1:n.202+27574C>T
                    10.

                    rs11042666 [Homo sapiens]
                      AAGGCTCTCCTACACAACCAAGAGA[A/T]ACTGAGGTGTCCAGCTAGCACCAGC
                      Chromosome:
                      11:10205846
                      Gene:
                      SBF2 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency
                      Global MAF:
                      T=0.2181/1092
                      HGVS:
                      CM000673.2:g.10205846A>T, NC_000011.10:g.10205846A>T, NC_000011.9:g.10227393A>T, NG_008074.1:g.93362T>A, NM_030962.3:c.56-11859T>A, XR_001747994.1:n.203-11859T>A
                      11.

                      rs11042617 [Homo sapiens]
                        GACCACCCTCCAAAAGGAGCAATTC[A/G]CACTTGAGGAAATGAGTGAAAACTT
                        Chromosome:
                        11:10086937
                        Gene:
                        SBF2 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency
                        Global MAF:
                        A=0.4407/2207
                        HGVS:
                        CM000673.2:g.10086937G>A, NC_000011.10:g.10086937G>A, NC_000011.9:g.10108484G>A, NG_008074.1:g.212271C>T, NM_030962.3:c.142-43956C>T, XR_001747994.1:n.289-43956C>T
                        12.

                        rs10734652 [Homo sapiens]
                          AATAGATGAAACTACAGTACTAAAC[C/T]TCAAGGTCCTAAAGAAAATACTGCT
                          Chromosome:
                          11:10128665
                          Gene:
                          SBF2 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          T=0.4730/2369
                          HGVS:
                          CM000673.2:g.10128665C>T, NC_000011.10:g.10128665C>T, NC_000011.9:g.10150212C>T, NG_008074.1:g.170543G>A, NM_030962.3:c.141+65237G>A, XR_001747994.1:n.288+65237G>A
                          14.

                          rs10500724 [Homo sapiens]
                            TTTTAAAAACTCTCACTGGATCTTA[C/G/T]TAAGTCTGCAATTTAATTCAACAAA
                            Chromosome:
                            11:10280469
                            Gene:
                            SBF2 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by cluster,by frequency
                            Global MAF:
                            T=0.4371/2189
                            HGVS:
                            CM000673.2:g.10280469C>G, CM000673.2:g.10280469C>T, NC_000011.10:g.10280469C>G, NC_000011.10:g.10280469C>T, NC_000011.9:g.10302016C>T, NG_008074.1:g.18739G>A, NG_008074.1:g.18739G>C, NM_030962.3:c.55+13546G>A, NM_030962.3:c.55+13546G>C, XR_001747994.1:n.202+13546G>A, XR_001747994.1:n.202+13546G>C
                            15.

                            rs9834312 [Homo sapiens]
                              AGGCCTCAGGCTCTTTGTCTTGGCA[A/G]CCTTTCGAGTTCTGTTTGAGATGAC
                              Chromosome:
                              3:58096982
                              Gene:
                              FLNB (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency
                              Global MAF:
                              G=0.3872/1939
                              HGVS:
                              CM000665.2:g.58096982G>A, NC_000003.11:g.58082709G>A, NC_000003.12:g.58096982G>A, NG_012801.1:g.93583G>A, NM_001164317.1:c.984+764G>A, NM_001164318.1:c.984+764G>A, NM_001164319.1:c.984+764G>A, NM_001457.2:c.984+764G>A, NM_001457.3:c.984+764G>A, XR_001740065.1:n.1129+764G>A, XR_940396.2:n.1129+764G>A
                              16.

                              rs8007661 [Homo sapiens]
                                AAATGTCCTGTCATCTTACATTTGC[C/T]GTGTCTACTCTAAACTATGACACCT
                                Chromosome:
                                14:91993614
                                Gene:
                                TRIP11 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency
                                Global MAF:
                                C=0.4852/2430
                                HGVS:
                                CM000676.2:g.91993614C>T, NC_000014.8:g.92459958C>T, NC_000014.9:g.91993614C>T, NG_016970.1:g.51446G>A, NM_001321851.1:c.5157+195G>A, NM_004239.4:c.5160+195G>A, XR_001750598.1:n.5451+195G>A, XR_943560.1:n.5615+195G>A
                                17.

                                rs7846385 [Homo sapiens]
                                  TGGTGGTCAGTTGGGAAAtttccag[C/T]tacagtttatctcagcactgacaat
                                  Chromosome:
                                  8:77247943
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency
                                  Global MAF:
                                  C=0.2244/1124
                                  HGVS:
                                  CM000670.2:g.77247943T>C, NC_000008.10:g.78160179T>C
                                  18.

                                  rs7129220 [Homo sapiens]
                                    aggattgagctgccaccctcttatc[A/G]ggacactagatttatggctgtggtc
                                    Chromosome:
                                    11:10328991
                                    Gene:
                                    CAND1.11 (GeneView)
                                    Functional Consequence:
                                    intron variant
                                    Validated:
                                    by 1000G,by cluster,by frequency
                                    Global MAF:
                                    A=0.0579/290
                                    HGVS:
                                    CM000673.2:g.10328991G>A, NC_000011.10:g.10328991G>A, NC_000011.9:g.10350538G>A, NR_103765.1:n.362-1579G>A
                                    19.

                                    rs7119000 [Homo sapiens]
                                      AGATGTAGTTATAGACTAGGGAGAA[C/T]AGAGAAAATTGAAAATGTGTACATT
                                      Chromosome:
                                      11:10074693
                                      Gene:
                                      SBF2 (GeneView)
                                      Functional Consequence:
                                      intron variant
                                      Validated:
                                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                      Global MAF:
                                      T=0.4529/2268
                                      HGVS:
                                      CM000673.2:g.10074693C>T, NC_000011.10:g.10074693C>T, NC_000011.9:g.10096240C>T, NG_008074.1:g.224515G>A, NM_030962.3:c.142-31712G>A, XR_001747994.1:n.289-31712G>A
                                      20.

                                      rs7108358 [Homo sapiens]
                                        AAATCATTACTTCAACTTAATTGCA[C/G]AAGTTAAATCAGCCCAGGATCTAGA
                                        Chromosome:
                                        11:10273293
                                        Gene:
                                        SBF2 (GeneView)
                                        Functional Consequence:
                                        intron variant
                                        Validated:
                                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                        Global MAF:
                                        G=0.3990/1998
                                        HGVS:
                                        CM000673.2:g.10273293C>G, NC_000011.10:g.10273293C>G, NC_000011.9:g.10294840C>G, NG_008074.1:g.25915G>C, NM_030962.3:c.55+20722G>C, XR_001747994.1:n.202+20722G>C

                                        Display Settings:

                                        Format
                                        Items per page
                                        Sort by

                                        Send to:

                                        Choose Destination

                                        Supplemental Content

                                        Find related data

                                        Recent activity

                                        Your browsing activity is empty.

                                        Activity recording is turned off.

                                        Turn recording back on

                                        See more...
                                        Support Center