Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 5

1.
2.

rs1042173 [Homo sapiens]
    CCATATATTTTCTGAGTAGCATATA[G/T]AATTTTATTGCTGGAATCTACTAGA
    Chromosome:
    17:30197993
    Gene:
    SLC6A4 (GeneView)
    Functional Consequence:
    utr variant 3 prime
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
    Global MAF:
    C=0.4852/2430
    HGVS:
    NC_000017.10:g.28525011A>C, NC_000017.11:g.30197993A>C, NG_011747.2:g.42944T>G, NM_001045.5:c.*463T>G, XM_005258025.1:c.*463T>G
    3.

    rs25531 [Homo sapiens]
      CTCGCGGCATCCCCCCTGCACCCCC[A/G]GCATCCCCCCTGCAGCCCCCCCAGC
      Chromosome:
      17:30237328
      Gene:
      LOC105371720 (GeneView) SLC6A4 (GeneView)
      Functional Consequence:
      intron variant,upstream variant 2KB
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      C=0.1376/689
      HGVS:
      NC_000017.10:g.28564346T>C, NC_000017.11:g.30237328T>C, NG_011747.2:g.3609A>G, NM_001045.5:c.-1936A>G, XM_005258025.1:c.-1810A>G, XR_001752824.1:n.280+258T>C
      4.

      rs6355 [Homo sapiens]
        TCAGCAGTTCCAAGTCCTGGTGCGG[C/G]AGATGACACACGGCACTCTATCCCA
        Chromosome:
        17:30221792
        Gene:
        SLC6A4 (GeneView)
        Functional Consequence:
        missense
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.0070/35
        HGVS:
        NC_000017.10:g.28548810C>G, NC_000017.11:g.30221792C>G, NG_011747.2:g.19145G>C, NM_001045.5:c.167G>C, NP_001036.1:p.Gly56Ala, XM_005258025.1:c.293G>C, XP_005258082.1:p.Gly98Ala
        5.

        rs6354 [Homo sapiens]
          GGCAAGGCGACCTTGCTTGCCCTCT[A/C]TTGCAGAATAACAAGGGGCTTAGCC
          Chromosome:
          17:30222880
          Gene:
          SLC6A4 (GeneView)
          Functional Consequence:
          utr variant 5 prime
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
          Global MAF:
          G=0.2037/1020
          HGVS:
          NC_000017.10:g.28549898G>T, NC_000017.11:g.30222880G>T, NG_011747.2:g.18057C>A, NM_001045.5:c.-185C>A, XM_005258025.1:c.-59C>A

          Display Settings:

          Format
          Sort by

          Send to:

          Choose Destination

          Supplemental Content

          Find related data

          Recent activity

          Your browsing activity is empty.

          Activity recording is turned off.

          Turn recording back on

          See more...
          Support Center