Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 9

1.

rs11159647 [Homo sapiens]
    ATACTCATATAGCAAAGCTGCACAT[A/G]TATCTAACATAACATTGAAATTTTA
    Chromosome:
    14:84308865
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.2925/1465
    HGVS:
    CM000676.2:g.84308865G>A, NC_000014.8:g.84775209G>A
    2.

    rs4777936 [Homo sapiens]
      ATGCTTACATCTGAGTCTTTGTGAA[C/G/T]GTCTCAGGACCCAATGCCAATGTTG
      Chromosome:
      15:93636203
      Gene:
      LOC107983974 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.4291/2149
      HGVS:
      CM000677.2:g.93636203T>C, CM000677.2:g.93636203T>G, NC_000015.10:g.93636203T>C, NC_000015.10:g.93636203T>G, NC_000015.9:g.94179432T>C, XR_001751681.1:n.1032+43470T>C, XR_001751681.1:n.1032+43470T>G
      3.

      rs4420638 [Homo sapiens]
        AATGTCACTATGCTACACTTTTCCT[A/G]GTGTGGTCTACCCGAGATGAGGGGC
        Chromosome:
        19:44919689
        Gene:
        APOC1 (GeneView)
        Functional Consequence:
        downstream variant 500B
        Allele Origin:
        G(unknown)/A(germline,unknown)
        Clinical significance:
        untested
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency
        Global MAF:
        G=0.1510/756
        HGVS:
        CM000681.2:g.44919689A>G, NC_000019.10:g.44919689A>G, NC_000019.9:g.45422946A>G, NG_012859.1:g.10026A>G, NM_001321065.1:c.*459A>G, NM_001321066.1:c.*459A>G, NM_001645.4:c.*459A>G
        4.

        rs3826656 [Homo sapiens]
          TGAGGATGCAGCTACCTCTCTATTA[A/G]TAAGGATGAATGAAGAGTTATCTAG
          Chromosome:
          19:51223357
          Gene:
          CD33 (GeneView)
          Functional Consequence:
          intron variant,upstream variant 2KB
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.3658/1832
          HGVS:
          CM000681.2:g.51223357G>A, NC_000019.10:g.51223357G>A, NC_000019.9:g.51726613G>A, NM_001082618.1:c.-1762G>A, NM_001177608.1:c.-1762G>A, NM_001772.3:c.-1762G>A
          5.

          rs2049161 [Homo sapiens]
            CTACTTTACTAGTGTATTTCCCAGC[A/C]GTTGACTTGATAATGATTTTTCAAA
            Chromosome:
            18:4127583
            Gene:
            DLGAP1 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency
            Global MAF:
            C=0.2079/1041
            HGVS:
            CM000680.2:g.4127583A>C, NC_000018.10:g.4127583A>C, NC_000018.9:g.4127583A>C, NM_001242761.1:c.-159+23597T>G, NM_004746.3:c.-159+23597T>G
            6.
            7.

            rs326656 [Homo sapiens]
              ATGCTTTGGTCATAACAGATTTTTT[A/T]AAAAACTTATTTAAATTCCATTCCA
              Chromosome:
              1:96315001
              Gene:
              LINC01787 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              A=0.1110/556
              HGVS:
              CM000663.2:g.96315001T>A, NC_000001.10:g.96780557T>A, NC_000001.11:g.96315001T>A, NR_110693.1:n.166-10663A>T, XR_246379.1:n.166-10663A>T
              8.

              rs179943 [Homo sapiens]
                GATGTTGACCTTTTGAAAAAAAAGT[C/T]CCATTTTCATGACAGATTGGCATAA
                Chromosome:
                6:16398087
                Gene:
                ATXN1 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                Global MAF:
                A=0.1931/967
                HGVS:
                CM000668.2:g.16398087G>A, NC_000006.11:g.16398318G>A, NC_000006.12:g.16398087G>A, NG_011571.1:g.368404C>T, NM_000332.3:c.-160-69617C>T, NM_001128164.1:c.-160-69617C>T, NM_001357857.1:c.-189-69617C>T
                9.

                Display Settings:

                Format
                Items per page
                Sort by

                Send to:

                Choose Destination

                Supplemental Content

                Find related data

                Recent activity

                Your browsing activity is empty.

                Activity recording is turned off.

                Turn recording back on

                See more...
                Support Center