Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 5

1.

rs28914834 [Homo sapiens]
    GGTGGCCATCAGCCCTCTGTTTCTC[C/G]TGGTGAGTTGCCATTTCCCTTCTCC
    Chromosome:
    17:30207734
    Gene:
    SLC6A4 (GeneView)
    Functional Consequence:
    missense
    Validated:
    by cluster,by frequency
    HGVS:
    CM000679.2:g.30207734G>C, NC_000017.10:g.28534752G>C, NC_000017.11:g.30207734G>C, NG_011747.2:g.33203C>G, NM_001045.5:c.1648C>G, NP_001036.1:p.Leu550Val, XP_005258082.1:p.Leu592Val
    2.

    rs28914833 [Homo sapiens]
      CGTCTGGGCCAAGCGCCGGGAGCGG[C/T]TCGTGCTCGCCGTGGTCATCACCTG
      Chromosome:
      17:30210571
      Gene:
      SLC6A4 (GeneView)
      Functional Consequence:
      missense
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      G=0.0032/16
      HGVS:
      CM000679.2:g.30210571A>G, NC_000017.10:g.28537589A>G, NC_000017.11:g.30210571A>G, NG_011747.2:g.30366T>C, NM_001045.5:c.1393T>C, NP_001036.1:p.Phe465Leu, XP_005258082.1:p.Phe507Leu
      3.

      rs28914832 [Homo sapiens]
        CATGCCAGCGTCCACTTTCTTTGCC[A/C/G]TCATCTTCTTTCTGATGTTAATCAC
        Chromosome:
        17:30211356
        Gene:
        SLC6A4 (GeneView)
        Functional Consequence:
        missense
        Allele Origin:
        G(germline)/A(germline)
        Clinical significance:
        other
        Validated:
        by 1000G,by cluster,by frequency
        Global MAF:
        C=0.0002/1
        HGVS:
        CM000679.2:g.30211356T>C, NC_000017.10:g.28538374T>C, NC_000017.10:g.28538374T>G, NC_000017.11:g.30211356T>C, NG_011747.2:g.29581A>C, NG_011747.2:g.29581A>G, NM_001045.5:c.1273A>C, NM_001045.5:c.1273A>G, NP_001036.1:p.Ile425Leu, NP_001036.1:p.Ile425Val, XP_005258082.1:p.Ile467Leu, XP_005258082.1:p.Ile467Val
        4.

        rs6355 [Homo sapiens]
          TCAGCAGTTCCAAGTCCTGGTGCGG[C/G]AGATGACACACGGCACTCTATCCCA
          Chromosome:
          17:30221792
          Gene:
          SLC6A4 (GeneView)
          Functional Consequence:
          missense
          Validated:
          by 1000G,by cluster,by frequency
          Global MAF:
          G=0.0070/35
          HGVS:
          CM000679.2:g.30221792C>G, NC_000017.10:g.28548810C>G, NC_000017.11:g.30221792C>G, NG_011747.2:g.19145G>C, NM_001045.5:c.167G>C, NP_001036.1:p.Gly56Ala, XP_005258082.1:p.Gly98Ala
          5.

          rs6352 [Homo sapiens]
            TGATCATCACTCCAGGGACATTTAA[A/C]GAGGTACGTGCTAGTTAGTGTGTAT
            Chromosome:
            17:30203175
            Gene:
            SLC6A4 (GeneView)
            Functional Consequence:
            missense
            Clinical significance:
            Likely benign
            Validated:
            by 1000G,by cluster,by frequency
            Global MAF:
            G=0.0086/43
            HGVS:
            CM000679.2:g.30203175T>G, NC_000017.10:g.28530193T>G, NC_000017.11:g.30203175T>G, NG_011747.2:g.37762A>C, NM_001045.5:c.1815A>C, NP_001036.1:p.Lys605Asn, XP_005258082.1:p.Lys647Asn

            Display Settings:

            Format
            Sort by

            Send to:

            Choose Destination

            Supplemental Content

            Find related data

            Recent activity

            Your browsing activity is empty.

            Activity recording is turned off.

            Turn recording back on

            See more...
            Support Center