Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 4

1.

rs41279496 [Homo sapiens]
    GAGGGCACAGGGGTGGGGGAGCCAG[G/T]CGTGGCCCCGCCCCCAGCCCGGGGC
    Chromosome:
    1:6149205
    Gene:
    CHD5 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    T=0.1300/651
    HGVS:
    NC_000001.10:g.6209265G>T, NC_000001.11:g.6149205G>T, NM_015557.2:c.1161+41C>A
    2.

    rs17489787 [Homo sapiens]
      ATCCCCCTTCTTGTCAAAGCTGCAA[C/G]ACGGTGAACAGATGTGGGTCGCTCA
      Chromosome:
      1:6144162
      Gene:
      CHD5 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.1669/836
      HGVS:
      NC_000001.10:g.6204222C>G, NC_000001.11:g.6144162C>G, NM_015557.2:c.1803-7G>C
      3.

      rs17029184 [Homo sapiens]
        CCGAGTCGTAGATGATGACAGTGTC[C/T]GCCGTGGCCAGGTTGATGCCCAGAC
        Chromosome:
        1:6130255
        Gene:
        CHD5 (GeneView) LOC105376687 (GeneView)
        Functional Consequence:
        synonymous codon,upstream variant 2KB
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.1048/525
        HGVS:
        NC_000001.10:g.6190315C>T, NC_000001.11:g.6130255C>T, NM_015557.2:c.3336G>A, NP_056372.1:p.Ala1112, XR_946912.1:n.-1508C>T
        4.

        rs2273032 [Homo sapiens]
          AGAGCCGCTCGGTGATTCGGGAGAA[C/T]GAGTTTTCCTTTGAGGACAACGCCA
          Chromosome:
          1:6142185
          Gene:
          CHD5 (GeneView)
          Functional Consequence:
          synonymous codon
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
          Global MAF:
          A=0.1328/665
          HGVS:
          NC_000001.10:g.6202245G>A, NC_000001.11:g.6142185G>A, NM_015557.2:c.2379C>T, NP_056372.1:p.Asn793

          Display Settings:

          Format
          Sort by

          Send to:

          Choose Destination

          Supplemental Content

          Find related data

          Recent activity

          Your browsing activity is empty.

          Activity recording is turned off.

          Turn recording back on

          See more...
          Support Center