Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 3

1.

rs7997012 [Homo sapiens]
    TGCCATTATCTTCAAAGACTTAATT[A/G]ACAATATTTGTCACTTGCCTATGCA
    Chromosome:
    13:46837850
    Gene:
    HTR2A (GeneView)
    Functional Consequence:
    intron variant
    Clinical significance:
    drug-response
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.2728/1366
    HGVS:
    CM000675.2:g.46837850A>G, NC_000013.10:g.47411985A>G, NC_000013.11:g.46837850A>G, NG_013011.1:g.64185T>C, NM_000621.4:c.614-2211T>C, NM_001165947.2:c.362-2211T>C
    2.

    rs2818224 [Homo sapiens]
      ttCCCAGGATGGAAAAAAAAACACA[A/C/T]AATTTTTCAAAATCAGGACACAAAG
      Chromosome:
      13:54260889
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      C=0.0827/414
      HGVS:
      CM000675.2:g.54260889T>A, CM000675.2:g.54260889T>C, NC_000013.10:g.54835024T>C

      Display Settings:

      Format
      Sort by

      Send to:

      Choose Destination

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center