Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 23

1.

rs11893432 [Homo sapiens]
    taactgtatctttgtatccattaac[C/G]aactttctcttatccccctgccctg
    Chromosome:
    2:191057148
    Gene:
    STAT4 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.2638/1321
    HGVS:
    CM000664.2:g.191057148C>G, NC_000002.11:g.191921874C>G, NC_000002.12:g.191057148C>G, NG_012852.1:g.99052G>C, NM_001243835.1:c.1206+870G>C, NM_003151.3:c.1206+870G>C
    2.

    rs11203367 [Homo sapiens]
      GTAGAGGTGACCCTGACGATGAAAG[C/T]GGCCAGTGGTAGCACAGGCGACCAG
      Chromosome:
      1:17331121
      Gene:
      PADI4 (GeneView)
      Functional Consequence:
      missense
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.4667/2337
      HGVS:
      CM000663.2:g.17331121T>C, NC_000001.10:g.17657616T>C, NC_000001.11:g.17331121T>C, NG_023261.2:g.27932T>C, NM_012387.2:c.245T>C, NP_036519.2:p.Val82Ala, NW_011332688.1:g.176344T>C, XP_011539452.1:p.Val82Ala, XP_011539453.1:p.Val82Ala, XP_011539455.1:p.Val82Ala, XP_011539456.1:p.Val82Ala, XP_011539457.1:p.Val82Ala, XP_011539458.1:p.Val82Ala
      3.

      rs10910099 [Homo sapiens]
        AGCACAGTGGGACCCGAGTTGTCGC[A/C]TGTTCTTAGAGTCAGAGGCCACTCA
        Chromosome:
        1:2602113
        Gene:
        MMEL1 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.4960/2484
        HGVS:
        CM000663.2:g.2602113A>C, NC_000001.10:g.2533552A>C, NC_000001.11:g.2602113A>C, NM_033467.3:c.1041+1771T>G, NT_187515.1:g.153303A>C, XR_001737402.1:n.1255+1771T>G
        4.

        rs10499194 [Homo sapiens]
          AATATTGATTTTCTTCAAATGTGTT[C/T]AACCCTTTTGTTCAAAAAGTAGTCA
          Chromosome:
          6:137681500
          Validated:
          by 1000G,by cluster,by frequency
          Global MAF:
          T=0.1915/959
          HGVS:
          CM000668.2:g.137681500C>T, NC_000006.11:g.138002637C>T
          5.

          rs10118357 [Homo sapiens]
            tcttctgaggacacttgggcctcct[A/C/G]gataatccaaggtcacctccccatc
            Chromosome:
            9:120917790
            Gene:
            TRAF1 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency
            Global MAF:
            A=0.4431/2219
            HGVS:
            CM000671.2:g.120917790G>A, CM000671.2:g.120917790G>C, NC_000009.11:g.123680068G>A, NC_000009.12:g.120917790G>A, NC_000009.12:g.120917790G>C, NG_023346.1:g.16384C>G, NG_023346.1:g.16384C>T, NM_001190945.1:c.229-3490C>G, NM_001190945.1:c.229-3490C>T, NM_005658.4:c.229-3490C>G, NM_005658.4:c.229-3490C>T
            6.

            rs7574865 [Homo sapiens]
              TATGAAAAGTTGGTGACCAAAATGT[G/T]AATAGTGGTTATCTTATTTCAGTGG
              Chromosome:
              2:191099907
              Gene:
              STAT4 (GeneView)
              Functional Consequence:
              intron variant
              Clinical significance:
              other
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.2554/1279
              HGVS:
              CM000664.2:g.191099907T>G, NC_000002.11:g.191964633T, NC_000002.11:g.191964633T>G, NC_000002.12:g.191099907T, NC_000002.12:g.191099907T>G, NG_012852.1:g.56293A, NG_012852.1:g.56293A>C, NM_001243835.1:c.274-23582A, NM_001243835.1:c.274-23582A>C, NM_003151.3:c.274-23582A, NM_003151.3:c.274-23582A>C
              7.

              rs6920220 [Homo sapiens]
                TTAGCAGGTAACTTCTCCACTAAAA[A/G]GATATGGTTCTGTAGAACAATGGCA
                Chromosome:
                6:137685367
                Validated:
                by 1000G,by cluster,by frequency
                Global MAF:
                A=0.0944/473
                HGVS:
                CM000668.2:g.137685367G>A, NC_000006.11:g.138006504G>A
                8.

                rs6822844 [Homo sapiens]
                  CCTGTCTCGCTCTCCATAGCAAAAA[G/T]AGAGGACTCTTTTCATGTTGCCACT
                  Chromosome:
                  4:122588266
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency
                  Global MAF:
                  T=0.0557/279
                  HGVS:
                  CM000666.2:g.122588266G>T, NC_000004.11:g.123509421G>T
                  12.

                  rs4750316 [Homo sapiens]
                    ACATTTGGAAGGAATGAGAGAATTA[C/G/T]AGTACCACCATTAGGTGACAATGAG
                    Chromosome:
                    10:6351298
                    Gene:
                    LOC399716 (GeneView)
                    Functional Consequence:
                    nc transcript variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency
                    Global MAF:
                    C=0.2167/1085
                    HGVS:
                    CM000672.2:g.6351298C>G, CM000672.2:g.6351298C>T, NC_000010.10:g.6393260C>G, NC_000010.11:g.6351298C>G, NC_000010.11:g.6351298C>T, NR_148966.1:n.983C>G, NR_148966.1:n.983C>T, XR_242715.1:n.1710C>G, XR_242715.3:n.4540C>G, XR_242715.3:n.4540C>T
                    13.

                    rs4572894 [Homo sapiens]
                      AAGATATTTGCTTACTTCAGACTGA[A/G]AGAACAAAGAAATAGAGAAATAAAA
                      Chromosome:
                      4:122551631
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency
                      Global MAF:
                      G=0.1687/845
                      HGVS:
                      CM000666.2:g.122551631A>G, NC_000004.11:g.123472786A>G
                      14.

                      rs3890745 [Homo sapiens]
                        TGGGGAAATTGTTACAAATCCAGAC[A/G]TTGGGCCCTCCCTCAGTTTGCCTGG
                        Chromosome:
                        1:2622185
                        Gene:
                        MMEL1 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        C=0.4846/2427
                        HGVS:
                        CM000663.2:g.2622185T>C, NC_000001.10:g.2553624T>C, NC_000001.11:g.2622185T>C, NM_033467.3:c.154+7146A>G, NT_187515.1:g.173375T>C, XR_001737402.1:n.368+7146A>G
                        15.

                        rs3761847 [Homo sapiens]
                          TCTGTGGGTCCCTTCTCTCCCCTCC[A/G]GCCTCAATACCACCCTCTCTACCTG
                          Chromosome:
                          9:120927961
                          Gene:
                          TRAF1 (GeneView)
                          Functional Consequence:
                          intron variant,upstream variant 2KB
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          G=0.4609/2308
                          HGVS:
                          CM000671.2:g.120927961G>A, NC_000009.11:g.123690239G>A, NC_000009.12:g.120927961G>A, NG_023346.1:g.6213C>T, NM_001190945.1:c.-366+1153C>T, NM_005658.4:c.-1638C>T
                          16.

                          rs3087243 [Homo sapiens]
                            TCTTCACCACTATTTGGGATATAAC[A/G]TGGGTTAACACAGACATAGCAGTCC
                            Chromosome:
                            2:203874196
                            Gene:
                            CTLA4 (GeneView)
                            Functional Consequence:
                            downstream variant 500B
                            Validated:
                            by 1000G,by cluster,by frequency,by submitter
                            Global MAF:
                            A=0.3690/1848
                            HGVS:
                            CM000664.2:g.203874196G>A, NC_000002.11:g.204738919G>A, NC_000002.12:g.203874196G>A, NG_011502.1:g.11411G>A, NM_001037631.2:c.*1421G>A, NM_005214.4:c.*1384G>A, XR_241294.1:n.2154G>A
                            17.

                            rs2812378 [Homo sapiens]
                              AAATTTGGCAGCTGAGGACTGTCCA[C/G/T]TTAGTTTGAGATAAGTGGGGCTGGG
                              Chromosome:
                              9:34710263
                              Gene:
                              CCL21 (GeneView)
                              Functional Consequence:
                              upstream variant 2KB
                              Validated:
                              by 1000G,by cluster,by frequency,by hapmap,by submitter
                              Global MAF:
                              G=0.3013/1509
                              HGVS:
                              CM000671.2:g.34710263G>A, CM000671.2:g.34710263G>C, NC_000009.11:g.34710260G>A, NC_000009.12:g.34710263G>A, NC_000009.12:g.34710263G>C, NM_002989.3:c.-197C>G, NM_002989.3:c.-197C>T, XR_242544.1:n.124+7225G>A
                              19.

                              rs2240340 [Homo sapiens]
                                CAAGGAGATTTCTGAAATCCCATCA[A/G]GTAAGAGGAGAGGTTGGTGAGGGTC
                                Chromosome:
                                1:17336144
                                Gene:
                                PADI4 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by cluster,by frequency
                                Global MAF:
                                T=0.4848/2428
                                HGVS:
                                CM000663.2:g.17336144T>C, NC_000001.10:g.17662639T>C, NC_000001.11:g.17336144T>C, NG_023261.2:g.32955T>C, NM_012387.2:c.341-15T>C, NW_011332688.1:g.181367T>C
                                20.

                                rs1883832 [Homo sapiens]
                                  GTCCTGCCGCCTGGTCTCACCTCGC[C/T]ATGGTTCGTCTGCCTCTGCAGTGCG
                                  Chromosome:
                                  20:46118343
                                  Gene:
                                  CD40 (GeneView)
                                  Functional Consequence:
                                  nc transcript variant,utr variant 5 prime
                                  Clinical significance:
                                  Benign
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by submitter
                                  Global MAF:
                                  T=0.2288/1146
                                  HGVS:
                                  CM000682.2:g.46118343T>C, NC_000020.10:g.44746982T>C, NC_000020.11:g.46118343T>C, NG_007279.1:g.5077T>C, NM_001250.4:c.-1T>C, NM_001250.5:c.-1T>C, NM_001302753.1:c.-1T>C, NM_001322421.1:c.-1T>C, NM_001322422.1:c.-1T>C, NM_152854.3:c.-1T>C, NR_126502.1:n.90T>C, NR_136327.1:n.90T>C, XR_244157.1:n.79T>C, XR_244158.1:n.79T>C

                                  Display Settings:

                                  Format
                                  Items per page
                                  Sort by

                                  Send to:

                                  Choose Destination

                                  Supplemental Content

                                  Find related data

                                  Recent activity

                                  Your browsing activity is empty.

                                  Activity recording is turned off.

                                  Turn recording back on

                                  See more...
                                  Support Center