Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 30

5.

rs13197301 [Homo sapiens]
    CGCCTGCTGACGTCAGCGCCTGCCT[A/G/T]CGCCGCCGTTCCCATGGCGACCGAT
    Chromosome:
    6:135497787
    Gene:
    AHI1 (GeneView) LINC00271 (GeneView)
    Functional Consequence:
    upstream variant 2KB
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.0166/83
    HGVS:
    NC_000006.11:g.135818925A>G, NC_000006.12:g.135497787A>G, NC_000006.12:g.135497787A>T, NG_008643.1:g.4979T>A, NG_008643.1:g.4979T>C, NM_001134830.1:c.-259T>A, NM_001134830.1:c.-259T>C, NM_001134831.1:c.-406T>A, NM_001134831.1:c.-406T>C, NM_001134832.1:c.-321T>A, NM_001134832.1:c.-321T>C, NM_017651.4:c.-321T>A, NM_017651.4:c.-321T>C, NR_026805.1:n.-14A>G, NR_026805.1:n.-14A>T, XM_005267038.1:c.-739T>C, XM_011535910.2:c.-577T>A, XM_011535910.2:c.-577T>C, XM_011535911.2:c.-344T>A, XM_011535911.2:c.-344T>C, XM_017010977.1:c.-515T>A, XM_017010977.1:c.-515T>C, XM_017010978.1:c.-739T>A, XM_017010978.1:c.-739T>C, XM_017010979.1:c.-739T>A, XM_017010979.1:c.-739T>C, XM_017010980.1:c.-739T>A, XM_017010980.1:c.-739T>C, XM_017010981.1:c.-406T>A, XM_017010981.1:c.-406T>C, XM_017010982.1:c.-739T>A, XM_017010982.1:c.-739T>C, XM_017010983.1:c.-739T>A, XM_017010983.1:c.-739T>C, XM_017010984.1:c.-739T>A, XM_017010984.1:c.-739T>C, XR_001743479.1:n.-538T>A, XR_001743479.1:n.-538T>C, XR_001743480.1:n.-538T>A, XR_001743480.1:n.-538T>C, XR_001743481.1:n.-538T>A, XR_001743481.1:n.-538T>C, XR_001743482.1:n.-538T>A, XR_001743482.1:n.-538T>C, XR_001743483.1:n.-538T>A, XR_001743483.1:n.-538T>C, XR_001743484.1:n.-538T>A, XR_001743484.1:n.-538T>C, XR_001743485.1:n.-538T>A, XR_001743485.1:n.-538T>C, XR_001743486.1:n.-538T>A, XR_001743486.1:n.-538T>C, XR_001743487.1:n.-538T>A, XR_001743487.1:n.-538T>C, XR_001743488.1:n.-49T>A, XR_001743488.1:n.-49T>C, XR_001743489.1:n.-538T>A, XR_001743489.1:n.-538T>C, XR_001743490.1:n.-538T>A, XR_001743490.1:n.-538T>C, XR_001743491.1:n.-538T>A, XR_001743491.1:n.-538T>C, XR_001743492.1:n.-538T>A, XR_001743492.1:n.-538T>C
    8.

    rs9494209 [Homo sapiens]
      TTGTCATTTTCACCTCTGTGCATTT[C/G/T]GGCAGCTCTTAACTTTTCTTCAATT
      Chromosome:
      6:135285617
      Gene:
      AHI1 (GeneView)
      Functional Consequence:
      nc transcript variant,utr variant 3 prime
      Clinical significance:
      Likely benign
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.1344/673
      HGVS:
      NC_000006.11:g.135606755C>G, NC_000006.12:g.135285617C>G, NC_000006.12:g.135285617C>T, NG_008643.1:g.217149G>A, NG_008643.1:g.217149G>C, NM_001134830.1:c.*28G>A, NM_001134830.1:c.*28G>C, NM_001134831.1:c.*28G>A, NM_001134831.1:c.*28G>C, NM_017651.4:c.*28G>A, NM_017651.4:c.*28G>C, XM_005267038.1:c.*28G>C, XM_005267039.1:c.*9G>C, XM_011535910.2:c.*28G>A, XM_011535910.2:c.*28G>C, XM_011535911.2:c.*28G>A, XM_011535911.2:c.*28G>C, XM_017010977.1:c.*28G>A, XM_017010977.1:c.*28G>C, XM_017010981.1:c.*28G>A, XM_017010981.1:c.*28G>C, XM_017010982.1:c.*9G>A, XM_017010982.1:c.*9G>C, XR_001743479.1:n.5369G>A, XR_001743479.1:n.5369G>C, XR_001743480.1:n.4197G>A, XR_001743480.1:n.4197G>C, XR_001743481.1:n.4162G>A, XR_001743481.1:n.4162G>C, XR_001743482.1:n.4065G>A, XR_001743482.1:n.4065G>C, XR_001743483.1:n.5266G>A, XR_001743483.1:n.5266G>C, XR_001743484.1:n.5230G>A, XR_001743484.1:n.5230G>C, XR_001743485.1:n.3926G>A, XR_001743485.1:n.3926G>C, XR_001743486.1:n.5127G>A, XR_001743486.1:n.5127G>C, XR_001743487.1:n.5352G>A, XR_001743487.1:n.5352G>C, XR_001743488.1:n.5783G>A, XR_001743488.1:n.5783G>C, XR_001743489.1:n.5067G>A, XR_001743489.1:n.5067G>C, XR_001743490.1:n.4048G>A, XR_001743490.1:n.4048G>C, XR_001743491.1:n.3701G>A, XR_001743491.1:n.3701G>C, XR_001743492.1:n.3598G>A, XR_001743492.1:n.3598G>C, XR_245541.1:n.6672G>C, XR_245542.1:n.5823G>C

      Display Settings:

      Format
      Items per page
      Sort by

      Send to:

      Choose Destination

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center