Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 11

1.

rs13281615 [Homo sapiens]
    GTAACTATGAATCTCATCAAAAGAA[A/G]GCAGAACGCAGATATTCTGAGTAGG
    Chromosome:
    8:127343372
    Gene:
    CASC21 (GeneView) CASC8 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.4912/2460
    HGVS:
    NC_000008.10:g.128355618A>G, NC_000008.11:g.127343372A>G, NR_117099.1:n.457+3937A>G, NR_117099.1:n.457+3938A>G, NR_117100.1:n.1177-53312T>C, NR_117100.1:n.1177-53313T>C
    2.

    rs12443621 [Homo sapiens]
      CGTTTTATATGCATTAGGCCTGGCA[A/G]TGAACTTGAGGTAGGTATTACTATC
      Chromosome:
      16:52514125
      Gene:
      TOX3 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.4906/2457
      HGVS:
      NC_000016.10:g.52514125A>G, NC_000016.9:g.52548037A>G, NG_012623.1:g.38678T>C, NM_001080430.3:c.87+32512T>C, NM_001146188.2:c.75+5281T>C, XM_005255892.1:c.87+32512T>C, XM_005255892.3:c.87+32512T>C, XM_005255893.1:c.75+5281T>C, XM_017023142.1:c.75+5281T>C
      3.

      rs8051542 [Homo sapiens]
        TTTAAACATTTAGGTTATTAGAGGA[C/T]GCAGCACTATGATTGGAGCAAAAAC
        Chromosome:
        16:52500255
        Gene:
        TOX3 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.3133/1569
        HGVS:
        NC_000016.10:g.52500255T>C, NC_000016.9:g.52534167T>C, NG_012623.1:g.52548A>G, NM_001080430.3:c.88-31681A>G, NM_001146188.2:c.75+19151A>G, XM_005255892.1:c.88-31681A>G, XM_005255892.3:c.88-31681A>G, XM_005255893.1:c.75+19151A>G, XM_017023142.1:c.75+19151A>G
        4.

        rs4666451 [Homo sapiens]
          tttggatagctgcataatgttctat[A/G]tgatggatattacatgattcttgaa
          Chromosome:
          2:19087182
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.2376/1190
          HGVS:
          NC_000002.11:g.19286943G>A, NC_000002.12:g.19087182G>A
          5.
          6.

          rs3803662 [Homo sapiens]
            TCTCCTTAATGCCTCTATAGCTGTC[C/T]CTTAGCGAAGAATAAAACTGTGGAC
            Chromosome:
            16:52552429
            Gene:
            CASC16 (GeneView)
            Functional Consequence:
            nc transcript variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.4403/2205
            HGVS:
            NC_000016.10:g.52552429A>G, NC_000016.9:g.52586341A>G, NG_012623.1:g.374T>C, NR_033920.1:n.659T>C, XR_243421.1:n.92T>C
            8.

            rs2107425 [Homo sapiens]
              CGACCTGAAGATCTGGTGCGGCTCC[C/T]ATGAGTGTCCTATTCCCAGATGACC
              Chromosome:
              11:1999845
              Gene:
              H19 (GeneView) MRPL23 (GeneView)
              Functional Consequence:
              intron variant,upstream variant 2KB
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
              Global MAF:
              T=0.4479/2243
              HGVS:
              NC_000011.10:g.1999845C>T, NC_000011.9:g.2021075C>T, NG_016165.1:g.2991G>A, NR_002196.2:n.-1970G>A, NR_131223.1:n.-1970G>A, NR_131224.1:n.249+1373G>A, XM_011520273.1:c.498-11696C>T, XM_011520275.2:c.498-11696C>T
              9.

              rs981782 [Homo sapiens]
                TTTTCAGATAACAATCTTGAAATTT[G/T]TCTCAGGGACCATGAAAATGAATAA
                Chromosome:
                5:45285616
                Gene:
                HCN1 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                C=0.2696/1350
                HGVS:
                NC_000005.10:g.45285616A>C, NC_000005.9:g.45285718A>C, NG_042183.1:g.415503T>G, NM_021072.3:c.1618+17983T>G
                10.

                rs889312 [Homo sapiens]
                  CTGAGATGCCCCTGCTGGAGAAAGG[A/C]ATGTGCAAATTAAGAGACTACAAAT
                  Chromosome:
                  5:56736057
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                  Global MAF:
                  C=0.3870/1938
                  HGVS:
                  NC_000005.10:g.56736057C>A, NC_000005.9:g.56031884C>A
                  11.

                  rs30099 [Homo sapiens]
                    CCTTGCAGCATTGGTCTGTATCTTC[C/T]CCCGAAATTATTCTTTCAAGTAAAC
                    Chromosome:
                    5:53122752
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    A=0.1937/970
                    HGVS:
                    NC_000005.10:g.53122752G>A, NC_000005.9:g.52418582G>A

                    Display Settings:

                    Format
                    Items per page
                    Sort by

                    Send to:

                    Choose Destination

                    Supplemental Content

                    Find related data

                    Recent activity

                    Your browsing activity is empty.

                    Activity recording is turned off.

                    Turn recording back on

                    See more...
                    Support Center