Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 9

1.

rs2070424 [Homo sapiens]
    GGGACATAGCTTTGTTAGCTATGCC[A/G]GTAATTAACAGGCATAACTCAGTAA
    Chromosome:
    21:31667007
    Gene:
    SOD1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.2484/1244
    HGVS:
    NC_000021.8:g.33039320A>G, NC_000021.9:g.31667007A>G, NG_008689.1:g.12386A>G, NM_000454.4:c.240-251A>G
    2.

    rs1800668 [Homo sapiens]
      GGAGGCGCCTGCTGGCCTCCCCTTA[C/T]AGTGCTTGTTCGGGGCGCTCCGCTG
      Chromosome:
      3:49358324
      Gene:
      GPX1 (GeneView)
      Functional Consequence:
      utr variant 5 prime
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.2011/1007
      HGVS:
      NC_000003.11:g.49395757G>A, NC_000003.12:g.49358324G>A, NG_012264.1:g.5035C>T, NG_051308.1:g.58774C>T, NM_000581.3:c.-46C>T, NM_001329455.1:c.-46C>T, NM_001329502.1:c.-46C>T, NM_001329503.1:c.-46C>T, NM_201397.2:c.-46C>T
      4.

      rs1050450 [Homo sapiens]
        ATCGAAGCCCTGCTGTCTCAAGGGC[C/T]CAGCTGTGCCTAGGGCGCCCCTCCT
        Chromosome:
        3:49357401
        Gene:
        GPX1 (GeneView)
        Functional Consequence:
        missense,utr variant 3 prime
        Allele Origin:
        T(germline)/C(germline)
        Clinical significance:
        Benign
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency
        Global MAF:
        A=0.2175/1089
        HGVS:
        NC_000003.11:g.49394834G>A, NC_000003.12:g.49357401G>A, NG_012264.1:g.5958C>T, NG_051308.1:g.59697C>T, NM_000581.3:c.599C>T, NM_001329455.1:c.461C>T, NM_001329502.1:c.*425C>T, NM_001329503.1:c.*105C>T, NM_201397.2:c.*581C>T, NP_000572.2:p.Pro200Leu, NP_001316384.1:p.Pro154Leu
        5.

        rs1001179 [Homo sapiens]
          CGCCCCGCCGGCCCGGGGTGCCCGG[A/G]ATAGCCGAACCCAGGGCGGGGCTCC
          Chromosome:
          11:34438684
          Gene:
          CAT (GeneView)
          Functional Consequence:
          upstream variant 2KB
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.1256/629
          HGVS:
          NC_000011.10:g.34438684C>T, NC_000011.9:g.34460231C>T, NG_013339.1:g.4760C>T, NM_001752.3:c.-330C>T
          6.

          rs769214 [Homo sapiens]
            TTTTCAAAATTCCTGCTTACCTGGG[A/G]GTAAAATTTGGGGAAGCAGATTTCT
            Chromosome:
            11:34438170
            Gene:
            CAT (GeneView)
            Functional Consequence:
            upstream variant 2KB
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.4726/2367
            HGVS:
            NC_000011.10:g.34438170G>A, NC_000011.9:g.34459717G>A, NG_013339.1:g.4246G>A, NM_001752.3:c.-844G>A
            7.

            rs699473 [Homo sapiens]
              CAGCACAGCTCTGGAGCAAATGCCA[C/T]GCACATTTGCAAGGTGCCCATTTCC
              Chromosome:
              4:24795181
              Gene:
              SOD3 (GeneView)
              Functional Consequence:
              upstream variant 2KB
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.4411/2209
              HGVS:
              NC_000004.11:g.24796803C>T, NC_000004.12:g.24795181C>T, NG_012213.1:g.4719C>T, NM_003102.2:c.-487C>T, XR_427488.1:n.-297C>T
              9.

              rs662 [Homo sapiens]
                CACTATTTTCTTGACCCCTACTTAC[A/G]ATCCTGGGAGATGTATTTGGGTTTA
                Chromosome:
                7:95308134
                Gene:
                PON1 (GeneView)
                Functional Consequence:
                missense
                Allele Origin:
                G(germline)/A(germline)
                Clinical significance:
                other
                Validated:
                by 1000G,by cluster,by frequency,by hapmap,by submitter
                Global MAF:
                T=0.4571/2289
                HGVS:
                NC_000007.13:g.94937446T>C, NC_000007.14:g.95308134T>C, NG_008779.1:g.21439A>G, NM_000446.5:c.575A>G, NP_000437.3:p.Gln192Arg

                Display Settings:

                Format
                Items per page
                Sort by

                Send to:

                Choose Destination

                Supplemental Content

                Find related data

                Recent activity

                Your browsing activity is empty.

                Activity recording is turned off.

                Turn recording back on

                See more...
                Support Center