Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs4149056 [Homo sapiens]
    TCTGGGTCATACATGTGGATATATG[C/T]GTTCATGGGTAATATGCTTCGTGGA
    Chromosome:
    12:21178615
    Gene:
    SLCO1B1 (GeneView)
    Functional Consequence:
    missense
    Clinical significance:
    drug-response
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.0877/439
    HGVS:
    NC_000012.11:g.21331549T>C, NC_000012.12:g.21178615T>C, NG_011745.1:g.52422T>C, NM_006446.4:c.521T>C, NP_006437.3:p.Val174Ala

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center