Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 52

1.

rs16910233 [Homo sapiens]
    TGTGAAAATGTAGTTTTACAATGCT[C/G]AAGGAATCATTAGCTTTCAATTAGC
    Chromosome:
    9:120961333
    Gene:
    C5 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.0593/297
    HGVS:
    NC_000009.11:g.123723611C>G, NC_000009.12:g.120961333C>G, NG_007364.1:g.93944G>C, NM_001317163.1:c.4606+149G>C, NM_001735.2:c.4588+149G>C, XM_011518980.2:c.4603+149G>C, XM_017015102.1:c.4603+149G>C, XM_017015103.1:c.4240+149G>C
    7.
    10.

    rs10818488 [Homo sapiens]
      GGCCAATGAGCAAGTGGGAGTGAGG[A/G]CACAAAGTGAGGCTTGGATCTGGTA
      Chromosome:
      9:120942809
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.4742/2375
      HGVS:
      NC_000009.11:g.123705087A>G, NC_000009.12:g.120942809A>G
      11.

      rs10760152 [Homo sapiens]
        TTTACTGGGTATGATGCCCTTGAGA[A/C]CCAGCTCAACTGCTGCATATATAAA
        Chromosome:
        9:121185707
        Gene:
        RAB14 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.2324/1164
        HGVS:
        NC_000009.11:g.123947985A>C, NC_000009.12:g.121185707A>C, NM_016322.3:c.351+1246T>G
        12.

        rs10760117 [Homo sapiens]
          TACATATTGAACCCCTGTCAAAGAT[G/T]AAGATATCCCTGAACAGGGCCAAGT
          Chromosome:
          9:120824459
          Gene:
          PSMD5 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.4892/2450
          HGVS:
          NC_000009.11:g.123586737T>G, NC_000009.12:g.120824459T>G, NM_001270427.1:c.877+35A>C, NM_005047.3:c.1006+35A>C, XM_011518866.2:c.1006+35A>C, XM_017014927.1:c.1006+35A>C, XM_017014928.1:c.364+35A>C
          13.

          rs10760112 [Homo sapiens]
            TTTGTTCTCAGTGCAAACTGTTCAA[C/T]GCCATGCATGCTGACACTAACACAT
            Chromosome:
            9:120705292
            Gene:
            MEGF9 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.4417/2212
            HGVS:
            NC_000009.11:g.123467570C>T, NC_000009.12:g.120705292C>T, NM_001080497.2:c.601+8466G>A
            14.

            rs10739575 [Homo sapiens]
              CCCTCTTGTCCTCCACTACCCTCAG[A/G]AAACCAAGAAAGACCAGCGTGGAGA
              Chromosome:
              9:120843823
              Gene:
              PSMD5-AS1 (GeneView) PSMD5 (GeneView)
              Functional Consequence:
              intron variant,upstream variant 2KB
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.2153/1078
              HGVS:
              NC_000009.11:g.123606101G>A, NC_000009.12:g.120843823G>A, NM_001270427.1:c.-914C>T, NM_005047.3:c.-914C>T, NR_024408.1:n.398+384G>A, XM_011518866.2:c.-914C>T, XM_017014927.1:c.-914C>T, XM_017014928.1:c.-1446C>T
              17.

              rs9409230 [Homo sapiens]
                TTGCTTCCTGCACAAAGGAGAACAC[A/T]GATGGAGAGAGACAGCACTGGAGGG
                Chromosome:
                9:121205482
                Gene:
                GSN (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                T=0.0266/133
                HGVS:
                NC_000009.11:g.123967760A>T, NC_000009.12:g.121205482A>T, XM_011518591.2:c.-857-2318A>T, XM_017014643.1:c.-861-2318A>T, XM_017014644.1:c.-795-2318A>T, XM_017014647.1:c.-1108-2318A>T
                18.

                rs9408928 [Homo sapiens]
                  taagcttaggaaacaccaaattaaa[C/T]aaagtcatacagcaaagaatttctt
                  Chromosome:
                  9:121189639
                  Gene:
                  RAB14 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  C=0.0288/144
                  HGVS:
                  NC_000009.11:g.123951917T>C, NC_000009.12:g.121189639T>C, NM_016322.3:c.284+915A>G
                  20.

                  rs7040033 [Homo sapiens]
                    GAATGTGCTTTGCACAAAATAAGTC[A/G]GTACATGTTTACTGAAGTGAATTTC
                    Chromosome:
                    9:120996766
                    Gene:
                    C5 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    A=0.4519/2263
                    HGVS:
                    NC_000009.11:g.123759044G>A, NC_000009.12:g.120996766G>A, NG_007364.1:g.58511C>T, NM_001317163.1:c.2809-466C>T, NM_001735.2:c.2791-466C>T, XM_011518980.2:c.2806-466C>T, XM_017015102.1:c.2806-466C>T, XM_017015103.1:c.2443-466C>T, XM_017015104.1:c.2806-466C>T

                    Display Settings:

                    Format
                    Items per page
                    Sort by

                    Send to:

                    Choose Destination

                    Supplemental Content

                    Find related data

                    Recent activity

                    Your browsing activity is empty.

                    Activity recording is turned off.

                    Turn recording back on

                    See more...
                    Support Center