Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 6

3.

rs689021 [Homo sapiens]
    AACACAGCGTCTGCAGCATGCAAGG[C/T]GTGGGTGGCTGCATCATCTGTAAGG
    Chromosome:
    11:121500411
    Gene:
    SORL1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.4221/2114
    HGVS:
    NC_000011.10:g.121500411G>A, NC_000011.9:g.121371120G>A, NG_023313.1:g.53160G>A, NM_003105.5:c.939+3362G>A, XM_011542963.2:c.939+3362G>A, XM_017018169.1:c.627+3362G>A, XM_017018170.1:c.414+3362G>A, XM_017018171.1:c.939+3362G>A
    4.

    rs668387 [Homo sapiens]
      TTCCTAGCACCTGCCAAGCCCTTTC[A/G]GAATGTTCGTCAATGTTGTCAATGT
      Chromosome:
      11:121497212
      Gene:
      SORL1 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
      Global MAF:
      T=0.4219/2113
      HGVS:
      NC_000011.10:g.121497212C>T, NC_000011.9:g.121367921C>T, NG_023313.1:g.49961C>T, NM_003105.5:c.939+163C>T, XM_011542963.2:c.939+163C>T, XM_017018169.1:c.627+163C>T, XM_017018170.1:c.414+163C>T, XM_017018171.1:c.939+163C>T
      5.

      rs661057 [Homo sapiens]
        AAATGAGTTTGCATTCTTTGATCTA[C/T]TGATAAGGGAAATGGCTGGCCTAAA
        Chromosome:
        11:121458245
        Gene:
        SORL1 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.4279/2143
        HGVS:
        NC_000011.10:g.121458245T>C, NC_000011.9:g.121328954T>C, NG_023313.1:g.10994T>C, NM_003105.5:c.285+5629T>C, XM_011542963.2:c.285+5629T>C, XM_017018169.1:c.-28+5417T>C, XM_017018171.1:c.285+5629T>C
        6.

        rs641120 [Homo sapiens]
          TAATATAGTTCTAAACTGACAGAGG[C/T]AATTTAATTTTTCACATATAATTTG
          Chromosome:
          11:121510256
          Gene:
          SORL1 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
          Global MAF:
          A=0.4052/2029
          HGVS:
          NC_000011.10:g.121510256G>A, NC_000011.9:g.121380965G>A, NG_023313.1:g.63005G>A, NM_003105.5:c.940-2747G>A, XM_011542963.2:c.940-2747G>A, XM_017018169.1:c.628-2747G>A, XM_017018170.1:c.415-2747G>A, XM_017018171.1:c.940-2747G>A

          Display Settings:

          Format
          Items per page
          Sort by

          Send to:

          Choose Destination

          Supplemental Content

          Find related data

          Recent activity

          Your browsing activity is empty.

          Activity recording is turned off.

          Turn recording back on

          See more...
          Support Center